BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J05216 1 BBa_J05216 Regulator for R3-ATF6 2005-09-07T11:00:00Z 2015-08-31T04:08:15Z binding sites for R1-CREBH and R4-cMaf false false _34_ 0 412 34 Not in stock false false Alexander Roth BBa_J05312 1 BBa_J05312 R3 state 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z -- No description -- false false _34_ 0 412 34 Not in stock false false Alexander Roth component2221749 1 BBa_B0034 component2221757 1 BBa_J05109 component2221747 1 BBa_J05216 component2221764 1 BBa_B0015 annotation2221747 1 BBa_J05216 range2221747 1 1 41 annotation2221749 1 BBa_B0034 range2221749 1 50 61 annotation2221757 1 BBa_J05109 range2221757 1 68 506 annotation2221764 1 BBa_B0015 range2221764 1 515 643 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J05109 1 R3 Repressor R3-ATF6 2005-09-03T11:00:00Z 2015-08-31T04:08:15Z R3-ATF6 (GGG GGC GAG) => (CTC GCC CCC GGG GGC GAG) false false _34_ 0 412 34 Not in stock false false Alexander Roth annotation1730087 1 Finger 3 range1730087 1 190 273 annotation1730088 1 ZF-GGG range1730088 1 223 246 annotation1730084 1 ZF-GAG range1730084 1 55 78 annotation1730086 1 ZF-GGC range1730086 1 139 162 annotation2214042 1 Help:Barcodes range2214042 1 415 439 annotation1730083 1 Finger 1 range1730083 1 22 105 annotation1730085 1 Finger 2 range1730085 1 106 189 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J05312_sequence 1 cgtcccctccggaggggacggctccggccccggggccggagtactagagaaagaggagaaatactagatgctggaaccgggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggccatctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagcgaatatatgctgggcctggaagcgcgcctgaaagcggcgctgagcgaaaacgaacagctgaaaaaagaaaacggcaccctgaaacgccagctggatgaagtggtgagcgaaaaccagcgcctgaaagtgtaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J05109_sequence 1 atgctggaaccgggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggccatctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagcgaatatatgctgggcctggaagcgcgcctgaaagcggcgctgagcgaaaacgaacagctgaaaaaagaaaacggcaccctgaaacgccagctggatgaagtggtgagcgaaaaccagcgcctgaaagtgtaataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J05216_sequence 1 cgtcccctccggaggggacggctccggccccggggccggag BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z