BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_J05313 1 BBa_J05313 R2 state 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z -- No description -- false false _34_ 0 412 34 Not in stock false false Alexander Roth component2221765 1 BBa_J05217 component2221775 1 BBa_J05110 component2221782 1 BBa_B0015 component2221767 1 BBa_B0034 annotation2221765 1 BBa_J05217 range2221765 1 1 41 annotation2221775 1 BBa_J05110 range2221775 1 68 533 annotation2221782 1 BBa_B0015 range2221782 1 542 670 annotation2221767 1 BBa_B0034 range2221767 1 50 61 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J05110 1 R2 Repressor R2-YAP7 2005-09-03T11:00:00Z 2015-08-31T04:08:15Z R2-YAP7 (GGA GGC GGG) => (CCC GCC TCC GGA GGC GGG) false false _34_ 0 412 34 Not in stock false false Alexander Roth annotation2214043 1 Help:Barcodes range2214043 1 442 466 annotation1730101 1 ZF-GGC range1730101 1 139 162 annotation1730099 1 ZF-GGG range1730099 1 55 78 annotation1730098 1 Finger 1 range1730098 1 22 105 annotation1730102 1 Finger 3 range1730102 1 190 273 annotation1730103 1 ZF-GGA range1730103 1 223 246 annotation1730100 1 Finger 2 range1730100 1 106 189 BBa_J05217 1 BBa_J05217 Regulator for R2-YAP7 2005-09-07T11:00:00Z 2015-08-31T04:08:15Z binding sites for R3-ATF6 and R4-cMaf false false _34_ 0 412 34 Not in stock false false Alexander Roth BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J05217_sequence 1 cctcgcccccgggggcgagggctccggccccggggccggag BBa_B0034_sequence 1 aaagaggagaaa BBa_J05313_sequence 1 cctcgcccccgggggcgagggctccggccccggggccggagtactagagaaagaggagaaatactagatgctggaaccgggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggccatctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagcgcgcgcatctggaacgccatcagcgcacccataccggcaaaaaaaccagcacccgcattcaggtgctggaagaaaaagtggaaatgctgcataacctggtggatgattggcagcgcaaatataaactgctggaaagcgaatttagcgataccaaagaaaacctgcaaaaaagcattgcgctgaacaacgaactgcaaaaagcgctgtaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J05110_sequence 1 atgctggaaccgggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggccatctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagcgcgcgcatctggaacgccatcagcgcacccataccggcaaaaaaaccagcacccgcattcaggtgctggaagaaaaagtggaaatgctgcataacctggtggatgattggcagcgcaaatataaactgctggaaagcgaatttagcgataccaaagaaaacctgcaaaaaagcattgcgctgaacaacgaactgcaaaaagcgctgtaataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z