BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J05314 1 BBa_J05314 R4 state 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z false false _34_ 0 412 34 Not in stock false false Alexander Roth component2221728 1 BBa_B0015 component2221711 1 BBa_J05218 component2221713 1 BBa_B0034 component2221721 1 BBa_J05111 annotation2221711 1 BBa_J05218 range2221711 1 1 41 annotation2221728 1 BBa_B0015 range2221728 1 533 661 annotation2221721 1 BBa_J05111 range2221721 1 68 524 annotation2221713 1 BBa_B0034 range2221713 1 50 61 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_J05111 1 R4 Repressor R4-cMaf 2005-09-03T11:00:00Z 2015-08-31T04:08:15Z R4-cMaf (GGG GCC GGA) => (TCC GGC CCC GGG GCC GGA) false false _34_ 0 412 34 Not in stock false false Alexander Roth annotation2214044 1 Help:Barcodes range2214044 1 433 457 annotation1730118 1 ZF-GGG range1730118 1 223 246 annotation1730113 1 Finger 1 range1730113 1 22 105 annotation1730114 1 ZF-GGA range1730114 1 55 78 annotation1730115 1 Finger 2 range1730115 1 106 189 annotation1730116 1 ZF-GCC range1730116 1 139 162 annotation1730117 1 Finger 3 range1730117 1 190 273 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J05218 1 BBa_J05218 Regulator for R4-cMaf 2005-09-07T11:00:00Z 2015-08-31T04:08:15Z binding sites for R1-CREBH and R2-YAP7 false false _34_ 0 412 34 Not in stock false false Alexander Roth BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J05111_sequence 1 atgctggaaccgggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagcgcgcgcatctggaacgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgattgccgcgatctggcgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagccagcagcgccatgtgctggaaagcgaaaaaaaccagctgctgcaacaggtggatcatctgaaacaggaaattagccgcctggtgcgcgaacgcgatgcgtataaagaaaaatatgaaaaactggtgagcagcggctttcgcgaaaactaataacactgatagtgctagtgtagatcac BBa_B0034_sequence 1 aaagaggagaaa BBa_J05218_sequence 1 cgtcccctccggaggggacggccccgcctccggaggcgggg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J05314_sequence 1 cgtcccctccggaggggacggccccgcctccggaggcggggtactagagaaagaggagaaatactagatgctggaaccgggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagcgcgcgcatctggaacgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgattgccgcgatctggcgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagccagcagcgccatgtgctggaaagcgaaaaaaaccagctgctgcaacaggtggatcatctgaaacaggaaattagccgcctggtgcgcgaacgcgatgcgtataaagaaaaatatgaaaaactggtgagcagcggctttcgcgaaaactaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z