BBa_J05514 1 BBa_J05514 my first temporary part *juhuu* 2006-06-11T11:00:00Z 2015-08-31T04:08:16Z TTT interactivity Well, what should I say... This part is of no use at all, so don't bother reading this description false false _34_ 0 417 34 Not in stock false Random sequence... Very difficult to make something that is really random. false Tamara Ulrich annotation1880678 1 my_start range1880678 1 10 35 annotation1880698 1 there_is_the_brick range1880698 1 80 140 annotation1883599 1 promote robin range1883599 1 20 50 annotation1880688 1 dont_know_what_this_is range1880688 1 41 80 annotation1880687 1 pretty_mutation range1880687 1 21 30 annotation1880689 1 hmmm range1880689 1 81 90 BBa_J05514_sequence 1 atcccatctacgttttagcgcgcatttcagagcgatcgagctgagacgagcactacttacgacgcggcgcgattatattatcgatgctaggagctatcggtagctagctagctgatcgtagcgaggcgatcgattttcgtagctagctgatgctgatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z