BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I14016 1 Las CIO P(Las) CIO 2004-07-29T11:00:00Z 2015-08-31T04:07:37Z Released HQ 2013 LasR and 3OC12HSL regulated promoter with CI Operator 1 (binding site for lambda cI repressor) false false _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1026125 1 -10 range1026125 1 140 145 annotation1026124 1 -35 range1026124 1 117 122 annotation1017859 1 R0079 range1017859 1 1 151 annotation1017878 1 CI lambda O1 range1017878 1 152 168 BBa_J06118 1 BBa_J06118 2005-06-26T11:00:00Z 2015-08-31T04:08:16Z false false _20_ 0 370 20 Not in stock false false orr component1546794 1 BBa_B0031 component1546786 1 BBa_E0032 component1546801 1 BBa_B0010 component1546774 1 BBa_B0034 component1546796 1 BBa_C0178 component1546769 1 BBa_I14016 component1546811 1 BBa_B0012 annotation1546786 1 BBa_E0032 range1546786 1 195 956 annotation1546769 1 BBa_I14016 range1546769 1 1 168 annotation1546796 1 BBa_C0178 range1546796 1 985 1593 annotation1546801 1 BBa_B0010 range1546801 1 1602 1681 annotation1546774 1 BBa_B0034 range1546774 1 177 188 annotation1546794 1 BBa_B0031 range1546794 1 965 978 annotation1546811 1 BBa_B0012 range1546811 1 1690 1730 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2159 1 2 range2159 1 757 762 annotation2160 1 SsrA range2160 1 718 756 annotation7041 1 BBa_E0032 range7041 1 1 762 annotation2156 1 YFP (LVA) range2156 1 1 762 annotation2161 1 A (Q->L) range2161 1 242 242 BBa_C0178 1 lasI autoinducer synthetase for PAI from Pseudomonas aeruginosa (no LVA) 2004-05-26T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 same as C0078 except no LVA tag false false _11_1_ 0 61 7 In stock false true jcbraff annotation1937124 1 lasI range1937124 1 1 609 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I14016_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacactacctctggcggtgata BBa_B0034_sequence 1 aaagaggagaaa BBa_C0178_sequence 1 atgatcgttcagatcggtcgtcgtgaagagttcgacaaaaaactgctgggtgaaatgcacaaactgcgtgctcaggttttcaaagaacgtaaaggttgggacgtttccgttatcgacgaaatggaaatcgacggttacgacgctctgtccccgtactacatgctgatccaggaagacaccccggaagctcaggttttcggttgctggcgtatcttcgacaccaccggtccgtacatgctgaaaaacaccttcccggaactgctgcacggtaaagaagctccgtgctccccgcacatctgggaactgtcccgtttcgctatcaactccggtcagaaaggttccctgggtttctccgactgcaccctggaagctatgcgtgctctggctcgttactccttgcagaacgacatccagaccctggttaccgttaccaccgttggtgttgaaaaaatgatgatccgtgctggtctggacgtttcccgtttcggtccgcacctgaaaatcggtatcgaacgtgctgttgctctgcgtatcgaactgaacgctaaaacccagatcgctctgtacggtggtgttctggttgaacagcgtctggctgtttcctaataa BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_J06118_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacactacctctggcggtgatatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagtcacacaggaaacctactagatgatcgttcagatcggtcgtcgtgaagagttcgacaaaaaactgctgggtgaaatgcacaaactgcgtgctcaggttttcaaagaacgtaaaggttgggacgtttccgttatcgacgaaatggaaatcgacggttacgacgctctgtccccgtactacatgctgatccaggaagacaccccggaagctcaggttttcggttgctggcgtatcttcgacaccaccggtccgtacatgctgaaaaacaccttcccggaactgctgcacggtaaagaagctccgtgctccccgcacatctgggaactgtcccgtttcgctatcaactccggtcagaaaggttccctgggtttctccgactgcaccctggaagctatgcgtgctctggctcgttactccttgcagaacgacatccagaccctggttaccgttaccaccgttggtgttgaaaaaatgatgatccgtgctggtctggacgtttcccgtttcggtccgcacctgaaaatcggtatcgaacgtgctgttgctctgcgtatcgaactgaacgctaaaacccagatcgctctgtacggtggtgttctggttgaacagcgtctggctgtttcctaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0031_sequence 1 tcacacaggaaacc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z