BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_C0079 1 lasr lasR activator from P. aeruginosa PAO1(+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z Genbank: NC_002516 (www.ncbi.nlm.nih.gov) Released HQ 2013 coding region for lasR protein, which accepts chemical signal AI-1 (made by lasI protein) false false _1_ 0 24 7 In stock false Mutated 480 from g to a to remove PstI site true Alvin Carter Powers (Fighting Darwins) annotation2213999 1 Help:Barcodes range2213999 1 757 781 annotation307935 1 lasR range307935 1 1 717 annotation307948 1 LVA range307948 1 718 750 annotation308006 1 G range308006 1 480 480 BBa_I14018 1 Bla P(Bla) 2004-08-01T11:00:00Z 2015-08-31T04:07:37Z Plasmid pUC19 Released HQ 2013 P(Bla), Medium Transcription false false _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1018027 1 P(Bla) range1018027 1 1 35 annotation1027020 1 -35 range1027020 1 4 9 annotation1027016 1 -10 range1027016 1 25 30 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0079 1 LasR+PAI Promoter (LasR & PAI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z "Analysis of the Pseudomonas aeruginosa Elastase (lasB) Regulatory Region". Lynn Rust, Everett Pesci, and Barbara Iglewski Released HQ 2013 Binding region for LasR protein (positive regulation) false true _1_ 0 24 7 In stock false true Alvin Carter Powers (Fighting Darwins) annotation318495 1 -35 range318495 1 117 122 annotation318496 1 -10 range318496 1 140 145 annotation300992 1 OP1 range300992 1 106 125 annotation300985 1 OP2 range300985 1 46 63 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2213991 1 Help:Barcodes range2213991 1 751 775 annotation23335 1 LVA range23335 1 712 744 annotation23334 1 cI lambda range23334 1 4 711 BBa_J06134 1 BBa_J06134 2005-06-26T11:00:00Z 2015-08-31T04:08:16Z false false _20_ 0 370 20 Not in stock false false orr component1544703 1 BBa_B0034 component1544698 1 BBa_I14018 component1544784 1 BBa_B0012 component1544722 1 BBa_B0010 component1544732 1 BBa_B0012 component1544768 1 BBa_C0051 component1544757 1 BBa_B0033 component1544716 1 BBa_C0079 component1544774 1 BBa_B0010 component1544749 1 BBa_R0079 annotation1544749 1 BBa_R0079 range1544749 1 988 1144 annotation1544784 1 BBa_B0012 range1544784 1 2041 2081 annotation1544703 1 BBa_B0034 range1544703 1 44 55 annotation1544716 1 BBa_C0079 range1544716 1 62 817 annotation1544698 1 BBa_I14018 range1544698 1 1 35 annotation1544757 1 BBa_B0033 range1544757 1 1153 1163 annotation1544732 1 BBa_B0012 range1544732 1 939 979 annotation1544774 1 BBa_B0010 range1544774 1 1953 2032 annotation1544722 1 BBa_B0010 range1544722 1 851 930 annotation1544768 1 BBa_C0051 range1544768 1 1170 1919 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0033_sequence 1 tcacacaggac BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_J06134_sequence 1 tgtaagtttatacataggcgagtactctgttatggtactagagaaagaggagaaatactagatggccttggttgacggttttcttgagctggaacgctcaagtggaaaattggagtggagcgccatcctccagaagatggcgagcgaccttggattctcgaagatcctgttcggcctgttgcctaaggacagccaggactacgagaacgccttcatcgtcggcaactacccggccgcctggcgcgagcattacgaccgggctggctacgcgcgggtcgacccgacggtcagtcactgtacccagagcgtactgccgattttctgggaaccgtccatctaccagacgcgaaagcagcacgagttcttcgaggaagcctcggccgccggcctggtgtatgggctgaccatgccgctgcatggtgctcgcggcgaactcggcgcgctgagcctcagcgtggaagcggaaaaccgggccgaggccaaccgtttcatagagtcggtcctgccgaccctgtggatgctcaaggactacgcactgcaaagcggtgccggactggccttcgaacatccggtcagcaaaccggtggttctgaccagccgggagaaggaagtgttgcagtggtgcgccatcggcaagaccagttgggagatatcggttatctgcaactgctcggaagccaatgtgaacttccatatgggaaatattcggcggaagttcggtgtgacctcccgccgcgtagcggccattatggccgttaatttgggtcttattactctcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagaggcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacacgaaagctactagagtcacacaggactactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_I14018_sequence 1 tgtaagtttatacataggcgagtactctgttatgg BBa_C0079_sequence 1 atggccttggttgacggttttcttgagctggaacgctcaagtggaaaattggagtggagcgccatcctccagaagatggcgagcgaccttggattctcgaagatcctgttcggcctgttgcctaaggacagccaggactacgagaacgccttcatcgtcggcaactacccggccgcctggcgcgagcattacgaccgggctggctacgcgcgggtcgacccgacggtcagtcactgtacccagagcgtactgccgattttctgggaaccgtccatctaccagacgcgaaagcagcacgagttcttcgaggaagcctcggccgccggcctggtgtatgggctgaccatgccgctgcatggtgctcgcggcgaactcggcgcgctgagcctcagcgtggaagcggaaaaccgggccgaggccaaccgtttcatagagtcggtcctgccgaccctgtggatgctcaaggactacgcactgcaaagcggtgccggactggccttcgaacatccggtcagcaaaccggtggttctgaccagccgggagaaggaagtgttgcagtggtgcgccatcggcaagaccagttgggagatatcggttatctgcaactgctcggaagccaatgtgaacttccatatgggaaatattcggcggaagttcggtgtgacctcccgccgcgtagcggccattatggccgttaatttgggtcttattactctcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0079_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacacgaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z