BBa_C0070 1 rhII autoinducer synthetase for N-butyryl-HSL (BHL) and HHL 2004-01-26T12:00:00Z 2015-08-31T04:07:23Z P. aeruginosa PA3476 Released HQ 2013 Autoinducer synthesis protein that produces N-butyryl-HSL which binds to RhlR, obtained from Pseudomonas aeruginosa. false false _1_ 0 24 7 In stock false Editing Check (1/28/04) (0) BB sites cleaned (1) ATG (2) TAATAA (3) Blast checks out (i.e., it's RhlI) (4) Codon changes OK (AA and tRNA usage) (5) Chassis might have conflict (w/ native autoinducer system?) (6) ssrA tag added (7) barcode added (8) Codon optimized for expression in enteric bacteria <P> 2 silent point mutations have been included into the sequence at base 138 from A to G and at base 576 from G to C to remove internal EcoRI and PstI sites. Mutations were chosen to yield the same amino acid and codons of similar frequency in E. coli. true Debra Lin, Srini Devadas, David Gray, Ronny Krashinsky, and Chris Zheng Liu, Boopers annotation306820 1 LVA range306820 1 604 636 annotation301203 1 rhlL range301203 1 1 603 annotation2213996 1 Help:Barcodes range2213996 1 643 667 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J06201 1 BBa_J06201 Tet repressible rhI generator (LVA+) 2005-06-23T11:00:00Z 2015-08-31T04:08:17Z Released HQ 2013 Generates rhI in response to aTc input. false true _20_ 0 339 20 In stock false false sash31 component1538063 1 BBa_R0040 component1538087 1 BBa_B0010 component1538097 1 BBa_B0012 component1538081 1 BBa_C0070 component1538071 1 BBa_B0034 annotation1538081 1 BBa_C0070 range1538081 1 81 722 annotation1538087 1 BBa_B0010 range1538087 1 756 835 annotation1538071 1 BBa_B0034 range1538071 1 63 74 annotation1538097 1 BBa_B0012 range1538097 1 844 884 annotation1538063 1 BBa_R0040 range1538063 1 1 54 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 BBa_J06201_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgttgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_C0070_sequence 1 atgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgttgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z