BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2156 1 YFP (LVA) range2156 1 1 762 annotation2159 1 2 range2159 1 757 762 annotation7041 1 BBa_E0032 range7041 1 1 762 annotation2161 1 A (Q->L) range2161 1 242 242 annotation2160 1 SsrA range2160 1 718 756 BBa_J06218 1 BBa_J06218 2005-06-26T11:00:00Z 2015-08-31T04:08:17Z false false _20_ 0 370 20 Not in stock false false orr component1549544 1 BBa_C0170 component1549517 1 BBa_I14017 component1549542 1 BBa_B0031 component1549534 1 BBa_E0032 component1549549 1 BBa_B0010 component1549522 1 BBa_B0034 component1549559 1 BBa_B0012 annotation1549522 1 BBa_B0034 range1549522 1 60 71 annotation1549549 1 BBa_B0010 range1549549 1 1485 1564 annotation1549559 1 BBa_B0012 range1549559 1 1573 1613 annotation1549517 1 BBa_I14017 range1549517 1 1 51 annotation1549544 1 BBa_C0170 range1549544 1 868 1476 annotation1549534 1 BBa_E0032 range1549534 1 78 839 annotation1549542 1 BBa_B0031 range1549542 1 848 861 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I14017 1 RhI P(Rhl) 2004-08-01T11:00:00Z 2015-08-31T04:07:37Z Released HQ 2013 RhlR and C4HSL regulated promoter. false true _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1043006 1 modified P(Rhl) range1043006 1 1 51 annotation1043007 1 -35 range1043007 1 21 50 annotation1043005 1 RhlR range1043005 1 1 20 BBa_C0170 1 rhII autoinducer synthetase for N-butyryl-HSL (BHL) and HHL (no LVA) 2004-05-26T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 same as C0070 except no LVA tag false true _11_1_ 0 61 7 In stock false true jcbraff annotation1891586 1 rhII range1891586 1 1 609 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_B0031_sequence 1 tcacacaggaaacc BBa_C0170_sequence 1 atgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgtttaataa BBa_J06218_sequence 1 tcctgcatgaattggtaggcttacgcaagaaaatggtttgttatagtcgaatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagtcacacaggaaacctactagatgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgtttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I14017_sequence 1 tcctgcatgaattggtaggcttacgcaagaaaatggtttgttatagtcgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z