BBa_C0170 1 rhII autoinducer synthetase for N-butyryl-HSL (BHL) and HHL (no LVA) 2004-05-26T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 same as C0070 except no LVA tag false true _11_1_ 0 61 7 In stock false true jcbraff annotation1891586 1 rhII range1891586 1 1 609 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I14017 1 RhI P(Rhl) 2004-08-01T11:00:00Z 2015-08-31T04:07:37Z Released HQ 2013 RhlR and C4HSL regulated promoter. false true _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1043006 1 modified P(Rhl) range1043006 1 1 51 annotation1043005 1 RhlR range1043005 1 1 20 annotation1043007 1 -35 range1043007 1 21 50 BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2159 1 2 range2159 1 757 762 annotation2161 1 A (Q->L) range2161 1 242 242 annotation7041 1 BBa_E0032 range7041 1 1 762 annotation2156 1 YFP (LVA) range2156 1 1 762 annotation2160 1 SsrA range2160 1 718 756 BBa_J06248 1 BBa_J06248 2005-06-26T11:00:00Z 2015-08-31T04:08:17Z false false _20_ 0 370 20 Not in stock false false orr component1549711 1 BBa_B0030 component1549683 1 BBa_I14017 component1549688 1 BBa_B0034 component1549700 1 BBa_E0032 component1549719 1 BBa_B0010 component1549714 1 BBa_C0170 component1549729 1 BBa_B0012 annotation1549688 1 BBa_B0034 range1549688 1 60 71 annotation1549719 1 BBa_B0010 range1549719 1 1486 1565 annotation1549700 1 BBa_E0032 range1549700 1 78 839 annotation1549714 1 BBa_C0170 range1549714 1 869 1477 annotation1549683 1 BBa_I14017 range1549683 1 1 51 annotation1549729 1 BBa_B0012 range1549729 1 1574 1614 annotation1549711 1 BBa_B0030 range1549711 1 848 862 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_C0170_sequence 1 atgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgtttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J06248_sequence 1 tcctgcatgaattggtaggcttacgcaagaaaatggtttgttatagtcgaatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagattaaagaggagaaatactagatgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgtttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I14017_sequence 1 tcctgcatgaattggtaggcttacgcaagaaaatggtttgttatagtcgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z