BBa_C0071 1 rhlR rhlR repressor/activator from P. aeruginosa PA3477 (+LVA) 2004-01-26T12:00:00Z 2015-08-31T04:07:23Z P. aeruginosa PA3477 Released HQ 2013 Transcriptional regulator, in complex with N-butyryl-HSL, RhlR binds to the Rhl promoter false false _1_ 0 24 7 In stock false (1/28/04 Edit Jamboree) (0) No BB sites (1) ATG (2) TAATAA (3) Blast checks out (4) No codon changes (5) Maybe chassis compatability (check by experiment) (6) Codon usage not optimal (but looks OK) (7) ssrA tag added true Debra Lin, Srini Devadas, David Gray, Ronny Krashinsky, and Chris Zheng Liu, Boopers annotation306523 1 LVA range306523 1 724 756 annotation2213995 1 Help:Barcodes range2213995 1 763 787 annotation301192 1 rhlR range301192 1 1 723 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J06402 1 BBa_J06402 C4HSL Receiver 2005-06-22T11:00:00Z 2015-08-31T04:08:17Z This device senses the C4HSL concentration in the media and produces output PoPS. RhlR production is controlled by constitutive P(BIa). This part is the C4HSL analog of F2621. false false _20_ 0 368 20 Not in stock false false kxjin component1534523 1 BBa_B0034 component1534518 1 BBa_I14018 component1534563 1 BBa_I14017 component1534533 1 BBa_C0071 component1534539 1 BBa_B0010 component1534549 1 BBa_B0012 annotation1534533 1 BBa_C0071 range1534533 1 62 823 annotation1534518 1 BBa_I14018 range1534518 1 1 35 annotation1534539 1 BBa_B0010 range1534539 1 857 936 annotation1534549 1 BBa_B0012 range1534549 1 945 985 annotation1534523 1 BBa_B0034 range1534523 1 44 55 annotation1534563 1 BBa_I14017 range1534563 1 994 1044 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I14017 1 RhI P(Rhl) 2004-08-01T11:00:00Z 2015-08-31T04:07:37Z Released HQ 2013 RhlR and C4HSL regulated promoter. false true _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1043005 1 RhlR range1043005 1 1 20 annotation1043007 1 -35 range1043007 1 21 50 annotation1043006 1 modified P(Rhl) range1043006 1 1 51 BBa_I14018 1 Bla P(Bla) 2004-08-01T11:00:00Z 2015-08-31T04:07:37Z Plasmid pUC19 Released HQ 2013 P(Bla), Medium Transcription false false _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1018027 1 P(Bla) range1018027 1 1 35 annotation1027020 1 -35 range1027020 1 4 9 annotation1027016 1 -10 range1027016 1 25 30 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_I14018_sequence 1 tgtaagtttatacataggcgagtactctgttatgg BBa_J06402_sequence 1 tgtaagtttatacataggcgagtactctgttatggtactagagaaagaggagaaatactagatgaggaatgacggaggctttttgctgtggtgggacggtttgcgtagcgagatgcagccgatccacgacagccagggcgtgttcgccgtcctggaaaaggaagtgcggcgcctgggcttcgattactacgcctatggcgtgcgccacacgattcccttcacccggccgaagaccgaggtccatggcacctatcccaaggcctggctggagcgataccagatgcagaactacggggccgtggatccggcgatcctcaacggcctgcgctcctcggaaatggtggtctggagcgacagcctgttcgaccagagccggatgctctggaacgaggctcgcgattggggcctctgtgtcggcgcgaccttgccgatccgcgcgccgaacaatttgctcagcgtgctttccgtggcgcgcgaccagcagaacatctccagcttcgagcgcgaggaaatccgcctgcggctgcgttgcatgatcgagttgctgacccagaagctgaccgacctggagcatccgatgctgatgtccaacccggtctgcctgagccatcgcgaacgcgagatcctgcaatggaccgccgacggcaagagttccggggaaatcgccatcatcctgagcatctccgagagcacggtgaacttccaccacaagaacatccagaagaagttcgacgcgccgaacaagacgctggctgccgcctacgccgcggcgctgggtctcatcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtcctgcatgaattggtaggcttacgcaagaaaatggtttgttatagtcgaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I14017_sequence 1 tcctgcatgaattggtaggcttacgcaagaaaatggtttgttatagtcgaa BBa_C0071_sequence 1 atgaggaatgacggaggctttttgctgtggtgggacggtttgcgtagcgagatgcagccgatccacgacagccagggcgtgttcgccgtcctggaaaaggaagtgcggcgcctgggcttcgattactacgcctatggcgtgcgccacacgattcccttcacccggccgaagaccgaggtccatggcacctatcccaaggcctggctggagcgataccagatgcagaactacggggccgtggatccggcgatcctcaacggcctgcgctcctcggaaatggtggtctggagcgacagcctgttcgaccagagccggatgctctggaacgaggctcgcgattggggcctctgtgtcggcgcgaccttgccgatccgcgcgccgaacaatttgctcagcgtgctttccgtggcgcgcgaccagcagaacatctccagcttcgagcgcgaggaaatccgcctgcggctgcgttgcatgatcgagttgctgacccagaagctgaccgacctggagcatccgatgctgatgtccaacccggtctgcctgagccatcgcgaacgcgagatcctgcaatggaccgccgacggcaagagttccggggaaatcgccatcatcctgagcatctccgagagcacggtgaacttccaccacaagaacatccagaagaagttcgacgcgccgaacaagacgctggctgccgcctacgccgcggcgctgggtctcatcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z