BBa_J06502 1 cI ts Lambda cI857 (E07700) (RBS- LVA+) 2005-06-13T11:00:00Z 2015-08-31T04:08:18Z GenBank E00770 (Japanese Patent) Mutated from BBa_C0051 Repressor, Lambda cI (RBS- LVA+) to be temperature sensitive and UV insensitive. true false _20_ 0 340 20 Discontinued false <p> First attempt to mutate failed. Suspect the problem is a low mutation rate due to results of positive control. May be a result of the mutagenesis kit being old. </p> <p> Second attempt to mutation failed. The best we got was 2 out of 3 mutations. The sequencing had a lot of bad sequence at the beginings, so that the ind- mutation was not sequenced by either of the primers used. The ind- mutation was tested by cutting with HindIII. </p> <p> <b>This part is being put on hold.</b> We may finish it by doing a single site mutation on one of the mutants with the other 2 sites successfully mutated. </p> false ytwang annotation1531454 1 cI857 range1531454 1 1 711 annotation1552045 1 barcode from lambda cI (BBa_C0051) range1552045 1 751 775 annotation1550569 1 G->A (ind-) range1550569 1 352 352 annotation1550572 1 C->G range1550572 1 681 681 annotation1550568 1 G->C range1550568 1 248 248 annotation1531464 1 LVA range1531464 1 712 744 BBa_J06502_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccacagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctaagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatggctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z