BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J06573 1 BBa_J06573 Construction intermediate: cI857 (Lamda II) with RBS (B0034.J06503) 2005-07-17T11:00:00Z 2015-08-31T04:08:18Z Building QPI from scratch true false _20_ 0 340 20 Discontinued false Abandoned in favor of using assembled cI857 QPI. false ytwang component1591906 1 BBa_B0034 component1591923 1 BBa_J06503 annotation1591906 1 BBa_B0034 range1591906 1 1 12 annotation1591923 1 BBa_J06503 range1591923 1 19 793 BBa_J06503 1 cI857 Lambda cI857 (Lambda II) (RBS- LVA+) 2005-06-27T11:00:00Z 2015-08-31T04:08:18Z <p> Hendrix, Roger W. <i>et al.</i>, ed. <i>Lambda II</i>. New York: Cold Spring Harbor Laboratory, 1983.<br /> ind- mutation on p. 626 (at bp 37589 of Lambda)<br /> 857 mutation on p. 628 (at bp 37742 of Lambda) </p> <p> Made by introducing two point mutations to Lambda cI (BBa_C0051): G(352)->A for ind- and G(199)->A for 857 temperature sensitivity. Mutated from BBa_C0051 Repressor, Lambda cI (RBS- LVA+) to be temperature sensitive and UV insensitive. false false _20_ 0 340 20 It's complicated false <p> First attempt to mutate failed. Suspect the problem is a low mutation rate due to results of positive control. May be a result of the mutagenesis kit being old. </p> <p> Second attempt to mutate succeeded. However, the sequencing had a lot of bad sequence at the beginings, so that the ind- mutation was not sequenced by either of the primers used. The ind- mutation was verified by the presence of a HindIII restrition site. </p> <p> <b>This part was never completely sequenced.</b> The cI857 QPI was made by Blue Heron, and this was part was abandoned. </p> false ytwang annotation1549979 1 LVA range1549979 1 712 744 annotation1549975 1 cI857 range1549975 1 1 711 annotation1552049 1 barcode from LacI-LVA (BBa_C0012) range1552049 1 751 775 annotation1549981 1 G->A (ind-) range1549981 1 352 352 annotation1549980 1 G->A (857) range1549980 1 199 199 BBa_B0034_sequence 1 aaagaggagaaa BBa_J06573_sequence 1 aaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttacaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctaagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_J06503_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttacaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctaagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z