BBa_E2030 1 BBa_E2030 enhanced version of EYFP, yeast-optimized 2005-01-24T12:00:00Z 2015-08-31T04:07:26Z nagai T. et al. (2002) Nat Biot (20):87-90 Released HQ 2013 Venus YFP, yeast codon optimized. EX515/EM528 false false _8_ 0 230 7 In stock false Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2060 (mCherry), BBa_E2050 (mOrange), and BBa_E2020 (Cerulean CFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Inserts a "V" after normal start M. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. Except for 5' and 3' ends no significant sequence identity runs with Cerulean CFP (BBa_E2020) or to GFP S65T as found in O'Shea deletion strain collection (originally from plasmid pFA6-GFP(S65T)-His3MX6). true ryu annotation1431979 1 MATSG linker range1431979 1 1 15 annotation2214039 1 Help:Barcodes range2214039 1 754 778 annotation1431978 1 Venus YFP range1431978 1 1 747 annotation1431980 1 GSGTA linker range1431980 1 733 747 BBa_J06657 1 BBa_J06657 Test of BBa_R0011 with Venus YFP 2005-07-05T11:00:00Z 2015-08-31T04:08:18Z -- No description -- false false _20_ 0 340 20 Not in stock false No fluorescence observed. J06700 (Venus YFP with RBS and T) is bad. false ytwang component1566633 1 BBa_B0010 component1566614 1 BBa_B0034 component1566643 1 BBa_B0012 component1566605 1 BBa_R0011 component1566627 1 BBa_E2030 annotation1566627 1 BBa_E2030 range1566627 1 82 834 annotation1566605 1 BBa_R0011 range1566605 1 1 54 annotation1566633 1 BBa_B0010 range1566633 1 868 947 annotation1566643 1 BBa_B0012 range1566643 1 956 996 annotation1566614 1 BBa_B0034 range1566614 1 64 75 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation1999 1 lac O1 range1999 1 3 19 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 annotation2000 1 -35 range2000 1 20 25 annotation2002 1 -10 range2002 1 43 48 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_E2030_sequence 1 atggcaactagcggcatggttagtaaaggagaagaacttttcactggagttgtcccaattttagttgaactagatggcgacgtgaacggtcataagttcagtgtctccggcgaaggtgagggtgatgcaacgtacggtaagttaactttgaagttaatatgtacaaccggcaagctgcctgttccctggcctaccctggtgacaacgttaggttatgggttgatgtgctttgctagatacccagatcacatgaaaaggcatgacttctttaaatctgcaatgccagaaggttacgtccaagaacgtactattttctttaaagatgacggtaattataaaactagggctgaagttaaattcgaaggtgacacacttgtaaatcgaatagagttaaaggggattgatttcaaagaggatggtaatattctaggccataaacttgaatataactataattcacacaacgtttacattaccgccgacaagcagaagaatggaatcaaagccaattttaagattagacacaatattgaggatggtggagtacagcttgctgatcattaccaacaaaataccccgatcggtgatggaccagttttgctacccgataaccattatctgtcctatcaaagcaaattgtcaaaagatcctaacgaaaaaagagaccacatggtactcttggaatttgtaacagctgctgggattacacatggcatggatgaactatacaaaggttctggtaccgcataataaccctgatagtgctagtgtagatccc BBa_J06657_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatggcaactagcggcatggttagtaaaggagaagaacttttcactggagttgtcccaattttagttgaactagatggcgacgtgaacggtcataagttcagtgtctccggcgaaggtgagggtgatgcaacgtacggtaagttaactttgaagttaatatgtacaaccggcaagctgcctgttccctggcctaccctggtgacaacgttaggttatgggttgatgtgctttgctagatacccagatcacatgaaaaggcatgacttctttaaatctgcaatgccagaaggttacgtccaagaacgtactattttctttaaagatgacggtaattataaaactagggctgaagttaaattcgaaggtgacacacttgtaaatcgaatagagttaaaggggattgatttcaaagaggatggtaatattctaggccataaacttgaatataactataattcacacaacgtttacattaccgccgacaagcagaagaatggaatcaaagccaattttaagattagacacaatattgaggatggtggagtacagcttgctgatcattaccaacaaaataccccgatcggtgatggaccagttttgctacccgataaccattatctgtcctatcaaagcaaattgtcaaaagatcctaacgaaaaaagagaccacatggtactcttggaatttgtaacagctgctgggattacacatggcatggatgaactatacaaaggttctggtaccgcataataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z