BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J06659 1 BBa_J06659 Test of BBa_R0052 with mCherry 2005-07-05T11:00:00Z 2015-08-31T04:08:18Z -- No description -- false false _20_ 0 340 20 Not in stock false No fluorescence observed. J06701 (mCherry with RBS and T) is bad. false ytwang component1566743 1 BBa_B0012 component1566714 1 BBa_B0034 component1566727 1 BBa_E2060 component1566733 1 BBa_B0010 component1566704 1 BBa_R0052 annotation1566733 1 BBa_B0010 range1566733 1 850 929 annotation1566743 1 BBa_B0012 range1566743 1 938 978 annotation1566704 1 BBa_R0052 range1566704 1 1 46 annotation1566727 1 BBa_E2060 range1566727 1 73 816 annotation1566714 1 BBa_B0034 range1566714 1 55 66 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0052 1 cI 434 Promoter (434 cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage 434 right operator Released HQ 2013 The 434 cI regulatory region sequence is a 89 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. 434 cI repressor protein, <bb_part>BBa_C0052<bb_part>, binds to it.<br> This segment contains O-R1, O-R2, P-R, and P-RM -35.</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2026 1 OR2 range2026 1 1 43 annotation2031 1 -35 range2031 1 2 7 annotation7068 1 BBa_R0052 range7068 1 1 46 annotation2027 1 OR2 range2027 1 8 21 annotation2029 1 -35 range2029 1 1 6 annotation2028 1 OR1 range2028 1 30 43 annotation2030 1 -10 range2030 1 24 29 annotation2032 1 start range2032 1 35 37 BBa_E2060 1 mCherry derivative of mRFP1, yeast-optimized 2005-01-24T12:00:00Z 2015-08-31T04:07:27Z Shaner et al, 2004. Nat Biotech (22):1567-1571 Released HQ 2013 mRFP (DsRed) derived, Ex587/Em610, yeast codon optimized false false _8_ 0 230 7 In stock false Codon optimized for yeast. Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2050 (mOrange), BBa_E2020 (Cerulean CFP), and BBa_E2030 (Venus YFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. except for 5' and 3' ends no significant sequence identity runs to mOrange (BBa_E2050). true ryu annotation2214037 1 Help:Barcodes range2214037 1 745 769 annotation1431927 1 MATSG linker range1431927 1 1 15 annotation1431931 1 GSGTA linker range1431931 1 724 738 annotation1431932 1 mCherry range1431932 1 1 738 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0052_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttga BBa_J06659_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagaaagaggagaaatactagatggcaactagcggcatggttagtaaaggagaagaaaataacatggcaatcattaaggagttcatgagattcaaagttcacatggaaggttctgtaaatggacatgaatttgaaatagaaggtgaaggagaaggaaggccttatgaaggaacccaaaccgcgaagctaaaagttactaagggtggcccattaccatttgcatgggatatccttagccctcaattcatgtatgggtcaaaggcttatgtcaagcaccccgccgacattccagactatctaaagttatcttttcccgaagggtttaagtgggagcgtgtgatgaacttcgaagacggtggcgtggtaacagtgactcaggattcgtccctgcaagatggtgaatttatctacaaagtcaaattaagaggaactaactttccatctgacggcccggttatgcaaaaaaagacaatgggctgggaggcctcctcagaacgaatgtaccctgaagatggtgccttgaagggtgagattaaacaaagattgaaattgaaagatggtggacattatgacgctgaggttaaaacgacatacaaagctaagaaacctgtccagctcccaggtgcttacaatgtaaatataaaacttgatattacatcacataatgaagattatacgatagttgaacaatacgaaagggctgaggggagacatagtactggtggcatggatgaactatacaaaggttctggtaccgcataataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E2060_sequence 1 atggcaactagcggcatggttagtaaaggagaagaaaataacatggcaatcattaaggagttcatgagattcaaagttcacatggaaggttctgtaaatggacatgaatttgaaatagaaggtgaaggagaaggaaggccttatgaaggaacccaaaccgcgaagctaaaagttactaagggtggcccattaccatttgcatgggatatccttagccctcaattcatgtatgggtcaaaggcttatgtcaagcaccccgccgacattccagactatctaaagttatcttttcccgaagggtttaagtgggagcgtgtgatgaacttcgaagacggtggcgtggtaacagtgactcaggattcgtccctgcaagatggtgaatttatctacaaagtcaaattaagaggaactaactttccatctgacggcccggttatgcaaaaaaagacaatgggctgggaggcctcctcagaacgaatgtaccctgaagatggtgccttgaagggtgagattaaacaaagattgaaattgaaagatggtggacattatgacgctgaggttaaaacgacatacaaagctaagaaacctgtccagctcccaggtgcttacaatgtaaatataaaacttgatattacatcacataatgaagattatacgatagttgaacaatacgaaagggctgaggggagacatagtactggtggcatggatgaactatacaaaggttctggtaccgcataataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z