BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961222 1 BBa_R0010 range1961222 1 1 200 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E2060 1 mCherry derivative of mRFP1, yeast-optimized 2005-01-24T12:00:00Z 2015-08-31T04:07:27Z Shaner et al, 2004. Nat Biotech (22):1567-1571 Released HQ 2013 mRFP (DsRed) derived, Ex587/Em610, yeast codon optimized false false _8_ 0 230 7 In stock false Codon optimized for yeast. Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2050 (mOrange), BBa_E2020 (Cerulean CFP), and BBa_E2030 (Venus YFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. except for 5' and 3' ends no significant sequence identity runs to mOrange (BBa_E2050). true ryu annotation1431927 1 MATSG linker range1431927 1 1 15 annotation2214037 1 Help:Barcodes range2214037 1 745 769 annotation1431931 1 GSGTA linker range1431931 1 724 738 annotation1431932 1 mCherry range1431932 1 1 738 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J06660 1 BBa_J06660 Test of BBa_R0010 with mCherry 2005-07-05T11:00:00Z 2015-08-31T04:08:18Z -- No description -- false false _20_ 0 340 20 Not in stock false No fluorescence observed. J06701 (mCherry with RBS and T) is bad. false ytwang component1566754 1 BBa_R0010 component1566778 1 BBa_E2060 component1566784 1 BBa_B0010 component1566765 1 BBa_B0034 component1566794 1 BBa_B0012 annotation1566778 1 BBa_E2060 range1566778 1 227 970 annotation1566794 1 BBa_B0012 range1566794 1 1092 1132 annotation1566754 1 BBa_R0010 range1566754 1 1 200 annotation1566765 1 BBa_B0034 range1566765 1 209 220 annotation1566784 1 BBa_B0010 range1566784 1 1004 1083 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J06660_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcaactagcggcatggttagtaaaggagaagaaaataacatggcaatcattaaggagttcatgagattcaaagttcacatggaaggttctgtaaatggacatgaatttgaaatagaaggtgaaggagaaggaaggccttatgaaggaacccaaaccgcgaagctaaaagttactaagggtggcccattaccatttgcatgggatatccttagccctcaattcatgtatgggtcaaaggcttatgtcaagcaccccgccgacattccagactatctaaagttatcttttcccgaagggtttaagtgggagcgtgtgatgaacttcgaagacggtggcgtggtaacagtgactcaggattcgtccctgcaagatggtgaatttatctacaaagtcaaattaagaggaactaactttccatctgacggcccggttatgcaaaaaaagacaatgggctgggaggcctcctcagaacgaatgtaccctgaagatggtgccttgaagggtgagattaaacaaagattgaaattgaaagatggtggacattatgacgctgaggttaaaacgacatacaaagctaagaaacctgtccagctcccaggtgcttacaatgtaaatataaaacttgatattacatcacataatgaagattatacgatagttgaacaatacgaaagggctgaggggagacatagtactggtggcatggatgaactatacaaaggttctggtaccgcataataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E2060_sequence 1 atggcaactagcggcatggttagtaaaggagaagaaaataacatggcaatcattaaggagttcatgagattcaaagttcacatggaaggttctgtaaatggacatgaatttgaaatagaaggtgaaggagaaggaaggccttatgaaggaacccaaaccgcgaagctaaaagttactaagggtggcccattaccatttgcatgggatatccttagccctcaattcatgtatgggtcaaaggcttatgtcaagcaccccgccgacattccagactatctaaagttatcttttcccgaagggtttaagtgggagcgtgtgatgaacttcgaagacggtggcgtggtaacagtgactcaggattcgtccctgcaagatggtgaatttatctacaaagtcaaattaagaggaactaactttccatctgacggcccggttatgcaaaaaaagacaatgggctgggaggcctcctcagaacgaatgtaccctgaagatggtgccttgaagggtgagattaaacaaagattgaaattgaaagatggtggacattatgacgctgaggttaaaacgacatacaaagctaagaaacctgtccagctcccaggtgcttacaatgtaaatataaaacttgatattacatcacataatgaagattatacgatagttgaacaatacgaaagggctgaggggagacatagtactggtggcatggatgaactatacaaaggttctggtaccgcataataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z