BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J06700 1 BBa_J06700 Venus YFP with RBS and forward terminator 2005-06-13T11:00:00Z 2015-08-31T04:08:18Z Combines BBa_B0034 RBS (Elowitz 1999) with BBa_J06600 Venus YFP with forward terminator false false _20_ 0 340 20 Not in stock false Test constructs involving this part had no fluorescence observed. Sequencing returned nothing resembling the expected part. false ytwang component1531734 1 BBa_B0010 component1531728 1 BBa_E2030 component1531715 1 BBa_B0034 component1531744 1 BBa_B0012 annotation1531744 1 BBa_B0012 range1531744 1 893 933 annotation1531728 1 BBa_E2030 range1531728 1 19 771 annotation1531734 1 BBa_B0010 range1531734 1 805 884 annotation1531715 1 BBa_B0034 range1531715 1 1 12 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_E2030 1 BBa_E2030 enhanced version of EYFP, yeast-optimized 2005-01-24T12:00:00Z 2015-08-31T04:07:26Z nagai T. et al. (2002) Nat Biot (20):87-90 Released HQ 2013 Venus YFP, yeast codon optimized. EX515/EM528 false false _8_ 0 230 7 In stock false Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2060 (mCherry), BBa_E2050 (mOrange), and BBa_E2020 (Cerulean CFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Inserts a "V" after normal start M. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. Except for 5' and 3' ends no significant sequence identity runs with Cerulean CFP (BBa_E2020) or to GFP S65T as found in O'Shea deletion strain collection (originally from plasmid pFA6-GFP(S65T)-His3MX6). true ryu annotation1431979 1 MATSG linker range1431979 1 1 15 annotation1431978 1 Venus YFP range1431978 1 1 747 annotation2214039 1 Help:Barcodes range2214039 1 754 778 annotation1431980 1 GSGTA linker range1431980 1 733 747 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J06700_sequence 1 aaagaggagaaatactagatggcaactagcggcatggttagtaaaggagaagaacttttcactggagttgtcccaattttagttgaactagatggcgacgtgaacggtcataagttcagtgtctccggcgaaggtgagggtgatgcaacgtacggtaagttaactttgaagttaatatgtacaaccggcaagctgcctgttccctggcctaccctggtgacaacgttaggttatgggttgatgtgctttgctagatacccagatcacatgaaaaggcatgacttctttaaatctgcaatgccagaaggttacgtccaagaacgtactattttctttaaagatgacggtaattataaaactagggctgaagttaaattcgaaggtgacacacttgtaaatcgaatagagttaaaggggattgatttcaaagaggatggtaatattctaggccataaacttgaatataactataattcacacaacgtttacattaccgccgacaagcagaagaatggaatcaaagccaattttaagattagacacaatattgaggatggtggagtacagcttgctgatcattaccaacaaaataccccgatcggtgatggaccagttttgctacccgataaccattatctgtcctatcaaagcaaattgtcaaaagatcctaacgaaaaaagagaccacatggtactcttggaatttgtaacagctgctgggattacacatggcatggatgaactatacaaaggttctggtaccgcataataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E2030_sequence 1 atggcaactagcggcatggttagtaaaggagaagaacttttcactggagttgtcccaattttagttgaactagatggcgacgtgaacggtcataagttcagtgtctccggcgaaggtgagggtgatgcaacgtacggtaagttaactttgaagttaatatgtacaaccggcaagctgcctgttccctggcctaccctggtgacaacgttaggttatgggttgatgtgctttgctagatacccagatcacatgaaaaggcatgacttctttaaatctgcaatgccagaaggttacgtccaagaacgtactattttctttaaagatgacggtaattataaaactagggctgaagttaaattcgaaggtgacacacttgtaaatcgaatagagttaaaggggattgatttcaaagaggatggtaatattctaggccataaacttgaatataactataattcacacaacgtttacattaccgccgacaagcagaagaatggaatcaaagccaattttaagattagacacaatattgaggatggtggagtacagcttgctgatcattaccaacaaaataccccgatcggtgatggaccagttttgctacccgataaccattatctgtcctatcaaagcaaattgtcaaaagatcctaacgaaaaaagagaccacatggtactcttggaatttgtaacagctgctgggattacacatggcatggatgaactatacaaaggttctggtaccgcataataaccctgatagtgctagtgtagatccc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z