BBa_J06701 1 BBa_J06701 mCherry with RBS and forward terminator 2005-06-13T11:00:00Z 2015-08-31T04:08:18Z Combines BBa_B0034 RBS (Elowitz 1999) with BBa_J06601 mCherry with forward terminator false false _20_ 0 340 20 It's complicated false Test constructs involving this part had no fluorescence observed. Sequencing returned nothing resembling the expected part. false ytwang component1531771 1 BBa_B0034 component1531790 1 BBa_B0010 component1531784 1 BBa_E2060 component1531800 1 BBa_B0012 annotation1531771 1 BBa_B0034 range1531771 1 1 12 annotation1531784 1 BBa_E2060 range1531784 1 19 762 annotation1531800 1 BBa_B0012 range1531800 1 884 924 annotation1531790 1 BBa_B0010 range1531790 1 796 875 BBa_E2060 1 mCherry derivative of mRFP1, yeast-optimized 2005-01-24T12:00:00Z 2015-08-31T04:07:27Z Shaner et al, 2004. Nat Biotech (22):1567-1571 Released HQ 2013 mRFP (DsRed) derived, Ex587/Em610, yeast codon optimized false false _8_ 0 230 7 In stock false Codon optimized for yeast. Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2050 (mOrange), BBa_E2020 (Cerulean CFP), and BBa_E2030 (Venus YFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. except for 5' and 3' ends no significant sequence identity runs to mOrange (BBa_E2050). true ryu annotation2214037 1 Help:Barcodes range2214037 1 745 769 annotation1431932 1 mCherry range1431932 1 1 738 annotation1431931 1 GSGTA linker range1431931 1 724 738 annotation1431927 1 MATSG linker range1431927 1 1 15 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_E2060_sequence 1 atggcaactagcggcatggttagtaaaggagaagaaaataacatggcaatcattaaggagttcatgagattcaaagttcacatggaaggttctgtaaatggacatgaatttgaaatagaaggtgaaggagaaggaaggccttatgaaggaacccaaaccgcgaagctaaaagttactaagggtggcccattaccatttgcatgggatatccttagccctcaattcatgtatgggtcaaaggcttatgtcaagcaccccgccgacattccagactatctaaagttatcttttcccgaagggtttaagtgggagcgtgtgatgaacttcgaagacggtggcgtggtaacagtgactcaggattcgtccctgcaagatggtgaatttatctacaaagtcaaattaagaggaactaactttccatctgacggcccggttatgcaaaaaaagacaatgggctgggaggcctcctcagaacgaatgtaccctgaagatggtgccttgaagggtgagattaaacaaagattgaaattgaaagatggtggacattatgacgctgaggttaaaacgacatacaaagctaagaaacctgtccagctcccaggtgcttacaatgtaaatataaaacttgatattacatcacataatgaagattatacgatagttgaacaatacgaaagggctgaggggagacatagtactggtggcatggatgaactatacaaaggttctggtaccgcataataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J06701_sequence 1 aaagaggagaaatactagatggcaactagcggcatggttagtaaaggagaagaaaataacatggcaatcattaaggagttcatgagattcaaagttcacatggaaggttctgtaaatggacatgaatttgaaatagaaggtgaaggagaaggaaggccttatgaaggaacccaaaccgcgaagctaaaagttactaagggtggcccattaccatttgcatgggatatccttagccctcaattcatgtatgggtcaaaggcttatgtcaagcaccccgccgacattccagactatctaaagttatcttttcccgaagggtttaagtgggagcgtgtgatgaacttcgaagacggtggcgtggtaacagtgactcaggattcgtccctgcaagatggtgaatttatctacaaagtcaaattaagaggaactaactttccatctgacggcccggttatgcaaaaaaagacaatgggctgggaggcctcctcagaacgaatgtaccctgaagatggtgccttgaagggtgagattaaacaaagattgaaattgaaagatggtggacattatgacgctgaggttaaaacgacatacaaagctaagaaacctgtccagctcccaggtgcttacaatgtaaatataaaacttgatattacatcacataatgaagattatacgatagttgaacaatacgaaagggctgaggggagacatagtactggtggcatggatgaactatacaaaggttctggtaccgcataataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z