BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J06906 1 BBa_J06906 Lambda cI QPI regulated by LacI with mCherry 2005-06-27T11:00:00Z 2015-08-31T04:08:19Z -- No description -- true false _20_ 0 340 20 Discontinued false false ytwang component1564323 1 BBa_B0010 component1564304 1 BBa_B0034 component1564265 1 BBa_C0051 component1564333 1 BBa_B0012 component1564246 1 BBa_R0011 component1564271 1 BBa_B0010 component1564255 1 BBa_B0034 component1564317 1 BBa_E2060 component1564296 1 BBa_R0051 component1564281 1 BBa_B0012 annotation1564246 1 BBa_R0011 range1564246 1 1 54 annotation1564255 1 BBa_B0034 range1564255 1 64 75 annotation1564265 1 BBa_C0051 range1564265 1 82 831 annotation1564271 1 BBa_B0010 range1564271 1 865 944 annotation1564281 1 BBa_B0012 range1564281 1 953 993 annotation1564323 1 BBa_B0010 range1564323 1 1854 1933 annotation1564333 1 BBa_B0012 range1564333 1 1942 1982 annotation1564296 1 BBa_R0051 range1564296 1 1002 1050 annotation1564304 1 BBa_B0034 range1564304 1 1059 1070 annotation1564317 1 BBa_E2060 range1564317 1 1077 1820 BBa_E2060 1 mCherry derivative of mRFP1, yeast-optimized 2005-01-24T12:00:00Z 2015-08-31T04:07:27Z Shaner et al, 2004. Nat Biotech (22):1567-1571 Released HQ 2013 mRFP (DsRed) derived, Ex587/Em610, yeast codon optimized false false _8_ 0 230 7 In stock false Codon optimized for yeast. Contains N- and C-terminal linker sequences (with homology to biobrick parts BBa_E2050 (mOrange), BBa_E2020 (Cerulean CFP), and BBa_E2030 (Venus YFP) to facilitate color swapping in yeast. Adds N-"MATSG" and "GSGTA"-C. to published amino acid sequence. Double TAATAA stop codon. Missing EcoRI, HindIII, NotI, NdeI, XhoI, RsrII, BamHI, NcoI, BglI, SpeI, XbaI, and PstI. except for 5' and 3' ends no significant sequence identity runs to mOrange (BBa_E2050). true ryu annotation1431932 1 mCherry range1431932 1 1 738 annotation1431931 1 GSGTA linker range1431931 1 724 738 annotation2214037 1 Help:Barcodes range2214037 1 745 769 annotation1431927 1 MATSG linker range1431927 1 1 15 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation1999 1 lac O1 range1999 1 3 19 annotation2000 1 -35 range2000 1 20 25 annotation2001 1 lac O1 range2001 1 26 42 annotation7064 1 BBa_R0011 range7064 1 1 54 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2023 1 -35 range2023 1 15 20 annotation2025 1 OR2 range2025 1 1 17 annotation2022 1 -10 range2022 1 38 43 annotation2024 1 OR1 range2024 1 25 41 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2213991 1 Help:Barcodes range2213991 1 751 775 annotation23335 1 LVA range23335 1 712 744 annotation23334 1 cI lambda range23334 1 4 711 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_J06906_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatggcaactagcggcatggttagtaaaggagaagaaaataacatggcaatcattaaggagttcatgagattcaaagttcacatggaaggttctgtaaatggacatgaatttgaaatagaaggtgaaggagaaggaaggccttatgaaggaacccaaaccgcgaagctaaaagttactaagggtggcccattaccatttgcatgggatatccttagccctcaattcatgtatgggtcaaaggcttatgtcaagcaccccgccgacattccagactatctaaagttatcttttcccgaagggtttaagtgggagcgtgtgatgaacttcgaagacggtggcgtggtaacagtgactcaggattcgtccctgcaagatggtgaatttatctacaaagtcaaattaagaggaactaactttccatctgacggcccggttatgcaaaaaaagacaatgggctgggaggcctcctcagaacgaatgtaccctgaagatggtgccttgaagggtgagattaaacaaagattgaaattgaaagatggtggacattatgacgctgaggttaaaacgacatacaaagctaagaaacctgtccagctcccaggtgcttacaatgtaaatataaaacttgatattacatcacataatgaagattatacgatagttgaacaatacgaaagggctgaggggagacatagtactggtggcatggatgaactatacaaaggttctggtaccgcataataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E2060_sequence 1 atggcaactagcggcatggttagtaaaggagaagaaaataacatggcaatcattaaggagttcatgagattcaaagttcacatggaaggttctgtaaatggacatgaatttgaaatagaaggtgaaggagaaggaaggccttatgaaggaacccaaaccgcgaagctaaaagttactaagggtggcccattaccatttgcatgggatatccttagccctcaattcatgtatgggtcaaaggcttatgtcaagcaccccgccgacattccagactatctaaagttatcttttcccgaagggtttaagtgggagcgtgtgatgaacttcgaagacggtggcgtggtaacagtgactcaggattcgtccctgcaagatggtgaatttatctacaaagtcaaattaagaggaactaactttccatctgacggcccggttatgcaaaaaaagacaatgggctgggaggcctcctcagaacgaatgtaccctgaagatggtgccttgaagggtgagattaaacaaagattgaaattgaaagatggtggacattatgacgctgaggttaaaacgacatacaaagctaagaaacctgtccagctcccaggtgcttacaatgtaaatataaaacttgatattacatcacataatgaagattatacgatagttgaacaatacgaaagggctgaggggagacatagtactggtggcatggatgaactatacaaaggttctggtaccgcataataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z