BBa_C0052 1 cI 434 cI repressor from phage 434 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage 434 Released HQ 2013 The 434 cI repressor protein coding sequence is a 710 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the 434 regulatory sequence, BBa_R0052. The sequence contains a LVA tag for faster degredation and has no RBS.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Nikolnikov,S., Posfai,G. and Sain,B. <em>The construction of a versatile plasmid vector that allows direct<br> selection of fragments cloned into six unique sites of the cI gene of coliphage 434</em>. Gene 30 (1-3), 261-265 (1984)<P> References (unparsed) here: <p>Nikolnikov,S., Posfai,G. and Sain,B. <em>The construction of a versatile plasmid vector that allows direct<br> selection of fragments cloned into six unique sites of the cI gene of coliphage 434</em>. Gene 30 (1-3), 261-265 (1984)<P><P> true Maia Mahoney annotation7035 1 BBa_C0052 range7035 1 1 669 annotation1743 1 cI 434 range1743 1 1 669 annotation1745 1 LVA range1745 1 631 669 annotation2213992 1 Help:Barcodes range2213992 1 670 694 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2022 1 -10 range2022 1 38 43 annotation2023 1 -35 range2023 1 15 20 annotation2025 1 OR2 range2025 1 1 17 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2024 1 OR1 range2024 1 25 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J06503 1 cI857 Lambda cI857 (Lambda II) (RBS- LVA+) 2005-06-27T11:00:00Z 2015-08-31T04:08:18Z <p> Hendrix, Roger W. <i>et al.</i>, ed. <i>Lambda II</i>. New York: Cold Spring Harbor Laboratory, 1983.<br /> ind- mutation on p. 626 (at bp 37589 of Lambda)<br /> 857 mutation on p. 628 (at bp 37742 of Lambda) </p> <p> Made by introducing two point mutations to Lambda cI (BBa_C0051): G(352)->A for ind- and G(199)->A for 857 temperature sensitivity. Mutated from BBa_C0051 Repressor, Lambda cI (RBS- LVA+) to be temperature sensitive and UV insensitive. false false _20_ 0 340 20 It's complicated false <p> First attempt to mutate failed. Suspect the problem is a low mutation rate due to results of positive control. May be a result of the mutagenesis kit being old. </p> <p> Second attempt to mutate succeeded. However, the sequencing had a lot of bad sequence at the beginings, so that the ind- mutation was not sequenced by either of the primers used. The ind- mutation was verified by the presence of a HindIII restrition site. </p> <p> <b>This part was never completely sequenced.</b> The cI857 QPI was made by Blue Heron, and this was part was abandoned. </p> false ytwang annotation1549981 1 G->A (ind-) range1549981 1 352 352 annotation1549980 1 G->A (857) range1549980 1 199 199 annotation1549979 1 LVA range1549979 1 712 744 annotation1552049 1 barcode from LacI-LVA (BBa_C0012) range1552049 1 751 775 annotation1549975 1 cI857 range1549975 1 1 711 BBa_R0052 1 cI 434 Promoter (434 cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage 434 right operator Released HQ 2013 The 434 cI regulatory region sequence is a 89 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. 434 cI repressor protein, <bb_part>BBa_C0052<bb_part>, binds to it.<br> This segment contains O-R1, O-R2, P-R, and P-RM -35.</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2026 1 OR2 range2026 1 1 43 annotation2031 1 -35 range2031 1 2 7 annotation2030 1 -10 range2030 1 24 29 annotation2032 1 start range2032 1 35 37 annotation2028 1 OR1 range2028 1 30 43 annotation7068 1 BBa_R0052 range7068 1 1 46 annotation2027 1 OR2 range2027 1 8 21 annotation2029 1 -35 range2029 1 1 6 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_J06965 1 BBa_J06965 434 cI/lambda cI857 (Lambda II) RS flip-flop with EYFP 2005-07-31T11:00:00Z 2015-08-31T04:08:19Z RS flip-flop with lambda cI857 (Lambda II) as the set and 434 cI as the reset. It will also take UV exposure as the set and heat (40??C) as the reset. false false _20_ 0 340 20 Not in stock false false Yves Wang component1600773 1 BBa_R0052 component1600734 1 BBa_C0052 component1600659 1 BBa_R0052 component1600741 1 BBa_B0010 component1600686 1 BBa_J06503 component1600800 1 BBa_B0012 component1600751 1 BBa_B0012 component1600783 1 BBa_B0034 component1600701 1 BBa_B0012 component1600785 1 BBa_E0030 component1600724 1 BBa_B0034 component1600790 1 BBa_B0010 component1600669 1 BBa_B0034 component1600691 1 BBa_B0010 component1600716 1 BBa_R0051 annotation1600734 1 BBa_C0052 range1600734 1 1068 1736 annotation1600783 1 BBa_B0034 range1600783 1 1961 1972 annotation1600800 1 BBa_B0012 range1600800 1 2798 2838 annotation1600751 1 BBa_B0012 range1600751 1 1858 1898 annotation1600790 1 BBa_B0010 range1600790 1 2710 2789 annotation1600741 1 BBa_B0010 range1600741 1 1770 1849 annotation1600691 1 BBa_B0010 range1600691 1 856 935 annotation1600785 1 BBa_E0030 range1600785 1 1979 2701 annotation1600773 1 BBa_R0052 range1600773 1 1907 1952 annotation1600716 1 BBa_R0051 range1600716 1 993 1041 annotation1600701 1 BBa_B0012 range1600701 1 944 984 annotation1600659 1 BBa_R0052 range1600659 1 1 46 annotation1600686 1 BBa_J06503 range1600686 1 73 847 annotation1600724 1 BBa_B0034 range1600724 1 1050 1061 annotation1600669 1 BBa_B0034 range1600669 1 55 66 BBa_E0030 1 eyfp enhanced yellow fluorescent protein derived from A. victoria GFP 2004-03-02T12:00:00Z 2015-08-31T04:07:25Z Modificaitons to Clontech EYFP by Reshma Shetty Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0052_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttga BBa_J06965_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttacaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctaagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_E0030_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa BBa_C0052_sequence 1 atgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J06503_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttacaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctaagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z