BBa_J07007 1 BBa_J07007 ctx promoter 2005-07-05T11:00:00Z 2015-08-31T04:08:19Z <a href="http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=155161">GENBANK M21250</a> V.cholerae ctx gene promoter region. Transcription takes place In the presence of a ToxR dimer. We don't have the -10 and -35 sites annotated (need to do this). false false _11_12_21_1_ 0 363 21 Not in stock false false igem_mit_2005 annotation1577387 1 transcription start range1577387 1 145 145 annotation1571612 1 ctx promoter range1571612 1 1 145 annotation1579234 1 -10 region range1579234 1 133 138 BBa_J07007_sequence 1 aacagaaaatgataaaaaaggactaatagtatattttgatttttgatttttgatttttgatttttgatttttgatttttgatttttgatttcaaataatacaaatttatttacttatttaattgttttgatcaattatttttctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z