BBa_J07036 1 BBa_J07036 Threshold: Repression module (cI repressor with junk region) 2005-07-21T11:00:00Z 2015-08-31T04:08:19Z Part of the thresholding device (works with j07037, j07038/j07039/j07040). This encodes the cI repressor that normally represses j07037. However, j07038/39/40 code for antisense mRNA to this, which, when transcribed, represses translation of cI and activates j07037 false false _21_ 0 379 21 Not in stock false false Yaser (Ray) Khan component1590563 1 BBa_I1030 component1590582 1 BBa_B0010 component1590592 1 BBa_B0012 annotation1590563 1 BBa_I1030 range1590563 1 1 840 annotation1590592 1 BBa_B0012 range1590592 1 937 977 annotation1590582 1 BBa_B0010 range1590582 1 849 928 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_I1030 1 BBa_I1030 RNA Regulation Target ( Promoter driven by C0040 and cI mod #1 CDS) 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z see references Coding region for the tetR promoter (<bb_part>BBa_C0040</bb_part>) with antisense binding region for <bb_part>BBa_I1031</bb_part> and <bb_part>BBa_I1032</bb_part>, and a codon modified cI(1) protein with an LVA degradation tail. false false _1_ 0 24 7 It's complicated false <P> <P> <bb_part>BBa_I1030</bb_part> Custom cI Protein with TetR Promoter is based on BioBricks <bb_part>BBa_C0050</bb_part> and <bb_part>BBa_R0040</bb_part>. It is designed such that <bb_part>BBa_I1031</bb_part> and <bb_part>BBa_I1032</bb_part>can be used to interfere with the <bb_part>BBa_1030</bb_part> transcript by anti-sense mRNA binding, in the KISS or micRNA method shown below. <bb_part>BBa_I1030</bb_part> and <bb_part>BBa_I1031</bb_part> or <bb_part>BBa_I1032</bb_part> can act indepently of related biobrick parts <bb_part>BBa_I1041</bb_part>, <bb_part>BBa_I1042</bb_part>, <bb_part>BBa_I1020</bb_part>, <bb_part>BBa_BBa_I1023</bb_part> and <bb_part>BBa_1013</bb_part>. [<A href="http://biobricks.ai.mit.edu/BB_References.htm#KEIL96">KEIL96</A>] <P> Incompatible with systems containing IPTG, or cI. <p> May be some cross talk with systems containing <bb_part>BBa_I1010</bb_part>. Compatible with all other BBa_line I-line parts. <p> Proper operation requires AMP/CAP complex, which should normally be present in the cell. false Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation1872 1 -10 range1872 1 43 48 annotation1880 1 intentional junk dna range1880 1 85 88 annotation1871 1 TetR 2 range1871 1 26 44 annotation1881 1 antisense RNA pairing range1881 1 55 162 annotation1870 1 -35 range1870 1 20 25 annotation1869 1 TetR 1 range1869 1 1 19 annotation1875 1 2 range1875 1 835 840 annotation1873 1 TetR range1873 1 1 54 annotation1868 1 modified cI1 cds range1868 1 94 163 annotation1877 1 intentional junk dna range1877 1 55 74 annotation1879 1 rbs range1879 1 77 82 annotation1866 1 cI range1866 1 91 840 annotation7050 1 BBa_I1030 range7050 1 1 840 annotation1878 1 start range1878 1 55 55 annotation1867 1 start range1867 1 91 93 annotation1874 1 SsrA range1874 1 802 840 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I1030_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacagctttgcacaacagcaacgacaggaaaccggttcgatgtcgacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_J07036_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacagctttgcacaacagcaacgacaggaaaccggttcgatgtcgacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z