BBa_J07045 1 BBa_J07045 J07014.B0015 (scFv 4M5.3.TT) 2005-08-02T11:00:00Z 2015-08-31T04:08:20Z Anti-fluorescein scFv (4M5.3, 15 point mutations) with transcriptional terminator. false false _21_ 0 350 21 It's complicated false false Jenny Nguyen component1651375 1 BBa_J07014 component1651390 1 BBa_B0012 component1651380 1 BBa_B0010 annotation1651390 1 BBa_B0012 range1651390 1 859 899 annotation1651375 1 BBa_J07014 range1651375 1 1 762 annotation1651380 1 BBa_B0010 range1651380 1 771 850 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J07014 1 BBa_J07014 scFv anti-fluorescein [4M5.3] 2005-07-07T11:00:00Z 2015-08-31T04:08:19Z see J07013. single chain Antibody fragment selected to bind to fluorescein molecules. This scFv is the strongest of the three specified sequences. false false _21_ 0 363 21 It's complicated false false mit_igem_2005 annotation1583271 1 F-V range1583271 1 178 180 annotation1582324 1 CDR3 VL range1582324 1 280 306 annotation1582330 1 CDR2 VH range1582330 1 559 615 annotation1583293 1 D-H range1583293 1 502 504 annotation1583294 1 I-F range1583294 1 562 564 annotation1583280 1 R-G range1583280 1 457 459 annotation1582343 1 S-A range1582343 1 712 714 annotation1582336 1 VH range1582336 1 412 762 annotation1582328 1 CDR1 VH range1582328 1 502 513 annotation1583288 1 A-T range1583288 1 481 483 annotation1583292 1 S-G range1583292 1 499 501 annotation1582325 1 linker range1582325 1 337 411 annotation1583279 1 D-G range1583279 1 412 414 annotation1583299 1 W-L range1583299 1 733 735 annotation1583297 1 Y-S range1583297 1 715 717 annotation1582335 1 VL range1582335 1 1 336 annotation1583287 1 P-A range1583287 1 460 462 annotation1583296 1 S-A range1583296 1 712 714 annotation1583278 1 S-N range1583278 1 241 243 annotation1583295 1 M-T range1583295 1 688 690 annotation1583298 1 D-E range1583298 1 727 729 annotation1582323 1 CDR2 VL range1582323 1 163 183 annotation1582331 1 CDR3 VH range1582331 1 711 732 annotation1582322 1 CDR1 VL range1582322 1 61 120 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J07045_sequence 1 gacgtcgttatgactcaaacaccactatcacttcctgttagtctaggtgatcaagcctccatctcttgcagatctagtcagagccttgtacacagtaatggaaacacctatttacgttggtacctgcaaaagccaggccagtctccaaaggtcctgatctacaaagtttccaaccgagtttctggggtcccagacaggttcagtggcagtggatcagggacagatttcacactcaagatcaacagagtggaggctgaggatctgggagtttatttctgctctcaaagtacacatgttccgtggacgttcggtggaggcaccaagcttgaaattaagtcctctgctgatgatgctaagaaggatgctgctaagaaggatgatgctaagaaagatgatgctaagaaagatggtggcgtcaaactggatgagactggaggaggcttggtgcaacctgggggggccatgaaactctcctgtgttacctctggattcacttttggtcactactggatgaactgggtccgccagtctccagagaaaggactggagtgggtagcacaatttagaaacaaaccttataattatgaaacatattattcagattctgtgaaaggcagattcaccatctcaagagatgattccaaaagtagtgtctacctgcaaatgaacaacttaagagttgaagacaccggtatctattactgtacgggtgcgtcttatggtatggaatacttaggtcaaggaacctcagtcaccgtctcctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J07014_sequence 1 gacgtcgttatgactcaaacaccactatcacttcctgttagtctaggtgatcaagcctccatctcttgcagatctagtcagagccttgtacacagtaatggaaacacctatttacgttggtacctgcaaaagccaggccagtctccaaaggtcctgatctacaaagtttccaaccgagtttctggggtcccagacaggttcagtggcagtggatcagggacagatttcacactcaagatcaacagagtggaggctgaggatctgggagtttatttctgctctcaaagtacacatgttccgtggacgttcggtggaggcaccaagcttgaaattaagtcctctgctgatgatgctaagaaggatgctgctaagaaggatgatgctaagaaagatgatgctaagaaagatggtggcgtcaaactggatgagactggaggaggcttggtgcaacctgggggggccatgaaactctcctgtgttacctctggattcacttttggtcactactggatgaactgggtccgccagtctccagagaaaggactggagtgggtagcacaatttagaaacaaaccttataattatgaaacatattattcagattctgtgaaaggcagattcaccatctcaagagatgattccaaaagtagtgtctacctgcaaatgaacaacttaagagttgaagacaccggtatctattactgtacgggtgcgtcttatggtatggaatacttaggtcaaggaacctcagtcaccgtctcc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z