BBa_J07009 1 BBa_J07009 toxicity-gene activator from Vibrio cholerae 2005-07-06T11:00:00Z 2015-08-31T04:08:19Z shortened BBa_J07008. Typical ToxR-periplasm-region subsitutions are done @ aa 211. explanation of ToxR domains @ http://model.mit.edu/igem/images/d/d7/Kolmar95.pdf ELIMINATE XbaI SITE PLZZZZZ false false _21_ 0 363 21 In stock true true mit_igem_2005 annotation1668509 1 Transmembrane Region range1668509 1 547 594 annotation1668510 1 Periplasmic Region range1668510 1 595 630 annotation1668506 1 Cytoplasmic Region range1668506 1 1 546 annotation1668507 1 Coding Sequence for ToxR' range1668507 1 1 630 annotation1668508 1 Start Codon range1668508 1 6 8 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_J07065 1 BBa_J07065 ToxR 2005-08-21T11:00:00Z 2015-08-31T04:08:20Z Front side of Tox_cell_signaling_by_dimerization_system. Recievers to be attached downstream of the Tox protein with intent to induce controlled dimerization of Tox. System used in conjunction with J07007 set of ctx_promotor::[reaction] parts. false false _21_ 0 363 21 Not in stock false false Will Bosworth component1668528 1 BBa_B0034 component1668520 1 BBa_R0040 component1668545 1 BBa_J07009 annotation1668545 1 BBa_J07009 range1668545 1 81 710 annotation1668528 1 BBa_B0034 range1668528 1 63 74 annotation1668520 1 BBa_R0040 range1668520 1 1 54 BBa_J07009_sequence 1 atgttcggattaggacacaactcaaaagagatatcgatgagtcatattggtactaaattcattcttgctgaaaaatttaccttcgatcccctaagcaatactctgattgacaaagaagatagtgaagagatcattcgattaggcagcaacgaaagccgaatcctttggctgctggcccaacgtccaaacgaggtaatttctcgcaatgatttgcatgactttgtttggcgagagcaaggttttgaagtcgatgattccagcttaacccaagccatttcgactctgcgcaaaatgctcaaagattcgacaaagtccccacaatacgtcaaaacggttccgaagcgcggttaccaattgatcgcccgagtggaaacggttgaagaagagatggctcgcgaaaacgaagctgctcatgacatctctcagccagaatctgtcaatgaatacgcagaatcaagcagtgtgccttcatcagccactgtagtgaacacaccgcagccagccaatgtcgtggcgaataaatcggctccaaacttggggaatcgactgtttattctgatagcggtcttacttcccctcgcagtattactgctcactaacccaagccaatccagctttaaacccctaacg BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J07065_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgttcggattaggacacaactcaaaagagatatcgatgagtcatattggtactaaattcattcttgctgaaaaatttaccttcgatcccctaagcaatactctgattgacaaagaagatagtgaagagatcattcgattaggcagcaacgaaagccgaatcctttggctgctggcccaacgtccaaacgaggtaatttctcgcaatgatttgcatgactttgtttggcgagagcaaggttttgaagtcgatgattccagcttaacccaagccatttcgactctgcgcaaaatgctcaaagattcgacaaagtccccacaatacgtcaaaacggttccgaagcgcggttaccaattgatcgcccgagtggaaacggttgaagaagagatggctcgcgaaaacgaagctgctcatgacatctctcagccagaatctgtcaatgaatacgcagaatcaagcagtgtgccttcatcagccactgtagtgaacacaccgcagccagccaatgtcgtggcgaataaatcggctccaaacttggggaatcgactgtttattctgatagcggtcttacttcccctcgcagtattactgctcactaacccaagccaatccagctttaaacccctaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z