BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961224 1 -35 range1961224 1 137 142 BBa_J07022 1 BBa_J07022 sigma factor FecI controls iron transport 2005-07-12T11:00:00Z 2015-08-31T04:08:19Z MG1655 FecI Coding sequence false false _21_ 0 379 21 It's complicated false false ymk annotation1577017 1 FecI range1577017 1 1 528 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_J07067 1 BBa_J07067 FecI test construct w/ inducible promoter 2005-08-21T11:00:00Z 2015-08-31T04:08:20Z Test construct for FecI Inducible promoter (regulated by LacI) + strong RBS (B0030) + FecI (J07022) false false _21_ 0 353 21 Not in stock false false Annie Vo component2219240 1 BBa_R0010 component2219248 1 BBa_B0030 component2219251 1 BBa_J07022 annotation2219248 1 BBa_B0030 range2219248 1 209 223 annotation2219240 1 BBa_R0010 range2219240 1 1 200 annotation2219251 1 BBa_J07022 range2219251 1 230 757 BBa_J07067_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagattaaagaggagaaatactagatgtctgaccgcgccactaccacagcttccttaacgttcgagtcgctttatggcacacatcacggctggttgaaaagctggctgacgcgcaaactccagtctgcttttgatgcagatgacattgcccaggacacttttttgcgggtaatggtcagcgaaacgctctcgacgatccgcgatcctcgctccttcctctgcactatcgccaaacgcgtgatggtggacctgtttcgccgaaacgcgctggaaaaagcgtatctggagatgctggcgcttatgccggaggggggagcgccttcacctgaggaacgcgaaagccaactcgagaccctacaactcctcgacagcatgctggacgggctaaacggcaaaacacgtgaagcgtttctgctttcgcaactggatggtctgacatacagcgagattgcgcacaaactcggtgtttccatcagctccgtgaaaaaatacgtggcgaaagccgtcgagcactgcctgctgttccgtctggagtatgggttatgataataa BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_J07022_sequence 1 atgtctgaccgcgccactaccacagcttccttaacgttcgagtcgctttatggcacacatcacggctggttgaaaagctggctgacgcgcaaactccagtctgcttttgatgcagatgacattgcccaggacacttttttgcgggtaatggtcagcgaaacgctctcgacgatccgcgatcctcgctccttcctctgcactatcgccaaacgcgtgatggtggacctgtttcgccgaaacgcgctggaaaaagcgtatctggagatgctggcgcttatgccggaggggggagcgccttcacctgaggaacgcgaaagccaactcgagaccctacaactcctcgacagcatgctggacgggctaaacggcaaaacacgtgaagcgtttctgctttcgcaactggatggtctgacatacagcgagattgcgcacaaactcggtgtttccatcagctccgtgaaaaaatacgtggcgaaagccgtcgagcactgcctgctgttccgtctggagtatgggttatgataataa BBa_B0030_sequence 1 attaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z