BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K199028 1 BBa_K199028 CGGUC tRNA Suppressor (Produces Serine) 2009-07-08T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CGGUC, which would normally cause a frame shift mutation. false false _295_ 0 5117 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CGGUC. false Alyndria Thompson annotation2010430 1 anticodon loop range2010430 1 44 52 annotation2010432 1 3 range2010432 1 104 143 annotation2010431 1 5' context range2010431 1 1 11 BBa_S04334 1 BBa_S04334 K199106:K199028 2009-11-18T12:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 5562 9 Not in stock false false Mary Gearing component2062784 1 BBa_K199106 component2062788 1 BBa_K199028 annotation2062784 1 BBa_K199106 range2062784 1 1 49 annotation2062788 1 BBa_K199028 range2062788 1 58 200 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J100002 1 BBa_J100002 pTet+RBS+Cre2SAT1Clause+pLpp+tRNA CGGUC 2011-05-23T11:00:00Z 2015-08-31T04:08:21Z N/A Suppressor tRNA CGGUC (K199028) is produced under regulation by the lpp promoter (K199106). The tRNA does not suppresses either of the frameshift mutations in Cre, causing Cre to be frameshifted and nonfunctional. We used this part as a control. false false _578_ 0 5111 9 Not in stock false N/A false Eric Sawyer component2120439 1 BBa_S04334 component2120421 1 BBa_R0040 component2120433 1 BBa_J100000 component2120427 1 BBa_B0034 annotation2120439 1 BBa_S04334 range2120439 1 1158 1357 annotation2120433 1 BBa_J100000 range2120433 1 81 1149 annotation2120421 1 BBa_R0040 range2120421 1 1 54 annotation2120427 1 BBa_B0034 range2120427 1 63 74 BBa_K199106 1 BBa_K199106 pLpp promoter 2009-11-18T12:00:00Z 2015-05-08T01:11:20Z The sequence matches that naturally found in E. coli. The lpp promoter is one of the strongest promoters in E. coli. false false _295_ 0 5562 9 Not in stock false n/a false Mary Gearing BBa_J100000 1 BBa_J100000 Cre with 8bp restriction sites and 1-Clause 2-SAT Problem Inserted 2011-05-23T11:00:00Z 2015-08-31T04:08:21Z N/A Cre recombines DNA at lox sites (J61046). After the start codon is an AsiSI site, followed by a SAT problem, followed by an AscI site. If the tRNA K199002 OR the tRNA K199001 is expressed in the cell, then Cre is read in-frame. If neither tRNA is expressed, then Cre is frameshifted. false false _578_ 0 5111 9 Not in stock false N/A false Eric Sawyer annotation2120392 1 AsiSI site range2120392 1 4 11 annotation2120391 1 Start range2120391 1 1 3 annotation2120393 1 1 Clause 2-SAT range2120393 1 13 23 annotation2120394 1 AscI site range2120394 1 28 35 annotation2120395 1 Remainder of Cre Recombinase range2120395 1 36 1069 BBa_K199028_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttgaccgacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199106_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacg BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J100000_sequence 1 atggcgatcgcaccactgctagttctgggcgcgcctccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattaagaatt BBa_S04334_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtttgaccgacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_J100002_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggcgatcgcaccactgctagttctgggcgcgcctccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattaagaatttactagagatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtttgaccgacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z