BBa_J100007 1 BBa_J100007 pLac+RBS+LoxP+Stop Sequence+LoxP 2011-05-23T11:00:00Z 2015-08-31T04:08:21Z N/A This stop sequence blocks transcription and translation by the formation of a stem-loop structure. In the presence of Cre recombinase, the stop sequence is excised from the DNA. A protein coding part placed downstream of this part will be expressed only in the presence of Cre. false false _578_ 0 5111 9 Not in stock false N/A false Eric Sawyer component2120480 1 BBa_R0010 component2120493 1 BBa_J100006 component2120488 1 BBa_B0034 annotation2120493 1 BBa_J100006 range2120493 1 229 533 annotation2120488 1 BBa_B0034 range2120488 1 209 220 annotation2120480 1 BBa_R0010 range2120480 1 1 200 BBa_J100005 1 BBa_J100005 Palindromic Stop Sequence 2011-05-23T11:00:00Z 2015-08-31T04:08:21Z N/A This palindromic sequence stops transcription and translation. This part works by forming a stem-loop in the mRNA. false false _578_ 0 5111 9 Not in stock false N/A false Eric Sawyer annotation2120465 1 Stem-loop range2120465 1 1 221 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961227 1 start range1961227 1 173 173 BBa_J100006 1 BBa_J100006 LoxP+Stop Sequence+LoxP 2011-05-23T11:00:00Z 2015-08-31T04:08:21Z N/A This stop sequence forms a stem-loop in the mRNA, inhibiting transcription and translation. In the presence of Cre recombinase, the stop sequence is excised from the DNA and therefore rendered non-functional. false false _578_ 0 5111 9 Not in stock false N/A false Eric Sawyer component2120476 1 BBa_J61046 component2120478 1 BBa_J100005 component2120479 1 BBa_J61046 annotation2120478 1 BBa_J100005 range2120478 1 43 263 annotation2120479 1 BBa_J61046 range2120479 1 272 305 annotation2120476 1 BBa_J61046 range2120476 1 1 34 BBa_J61046 1 lox [Lox] site for recombination 2007-02-20T12:00:00Z 2015-08-31T02:03:00Z bob Released HQ 2013 bob false false _95_ 0 483 95 In stock false bob true John Anderson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J100005_sequence 1 aaggcctgattatgaagagcgtgtgacagagacacatagaatatctcacacgacatggcagttaaataataaaaaagccggattaataatctggctttttattattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagcgtgaactgccaatctgggttaagttatcttaggttttctgcaccgcgccttctttaatcaggcctt BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J61046_sequence 1 ataacttcgtataatgtatgctatacgaagttat BBa_J100006_sequence 1 ataacttcgtataatgtatgctatacgaagttattactagagaaggcctgattatgaagagcgtgtgacagagacacatagaatatctcacacgacatggcagttaaataataaaaaagccggattaataatctggctttttattattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagcgtgaactgccaatctgggttaagttatcttaggttttctgcaccgcgccttctttaatcaggcctttactagagataacttcgtataatgtatgctatacgaagttat BBa_J100007_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagagataacttcgtataatgtatgctatacgaagttattactagagaaggcctgattatgaagagcgtgtgacagagacacatagaatatctcacacgacatggcagttaaataataaaaaagccggattaataatctggctttttattattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagcgtgaactgccaatctgggttaagttatcttaggttttctgcaccgcgccttctttaatcaggcctttactagagataacttcgtataatgtatgctatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z