BBa_S04334 1 BBa_S04334 K199106:K199028 2009-11-18T12:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 5562 9 Not in stock false false Mary Gearing component2062784 1 BBa_K199106 component2062788 1 BBa_K199028 annotation2062784 1 BBa_K199106 range2062784 1 1 49 annotation2062788 1 BBa_K199028 range2062788 1 58 200 BBa_K199001 1 BBa_K199001 CUAGU tRNA Suppressor (Produces Serine) 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CUAGU, which would normally cause a frame shift mutation. false false _295_ 0 5109 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CUAGU. false Romina Clemente annotation2006704 1 5' Context range2006704 1 1 11 annotation2006705 1 Anticodon Loop range2006705 1 44 52 annotation2006706 1 3' Context range2006706 1 104 143 BBa_K199028 1 BBa_K199028 CGGUC tRNA Suppressor (Produces Serine) 2009-07-08T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CGGUC, which would normally cause a frame shift mutation. false false _295_ 0 5117 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CGGUC. false Alyndria Thompson annotation2010430 1 anticodon loop range2010430 1 44 52 annotation2010432 1 3 range2010432 1 104 143 annotation2010431 1 5' context range2010431 1 1 11 BBa_K199106 1 BBa_K199106 pLpp promoter 2009-11-18T12:00:00Z 2015-05-08T01:11:20Z The sequence matches that naturally found in E. coli. The lpp promoter is one of the strongest promoters in E. coli. false false _295_ 0 5562 9 Not in stock false n/a false Mary Gearing BBa_K199002 1 BBa_K199002 CCACU tRNA Suppressor (Produces Serine) 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CCACU, which would normally cause a frame shift mutation. false false _295_ 0 5109 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CCACU. false Shamita Punjabi annotation2006708 1 Anticodon Loop range2006708 1 44 52 annotation2006709 1 3' Context range2006709 1 104 143 annotation2006707 1 5' Context range2006707 1 1 11 BBa_S04336 1 BBa_S04336 K199106:K199001 2009-11-18T12:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 5562 9 Not in stock false false Mary Gearing component2062798 1 BBa_K199001 component2062794 1 BBa_K199106 annotation2062794 1 BBa_K199106 range2062794 1 1 49 annotation2062798 1 BBa_K199001 range2062798 1 58 200 BBa_J100011 1 BBa_J100011 pLpp-tRNA CCACU-pLpp-tRNA CUAGU-pLpp-tRNA CGGUC 2011-06-08T11:00:00Z 2015-08-31T04:08:21Z N/A Produces suppressor tRNAs CCACU, CUAGU, and CGGUC, each under regulation of the lpp promoter. false false _578_ 0 5111 9 Not in stock false N/A false Eric Sawyer component2120815 1 BBa_S04336 component2120821 1 BBa_S04334 component2120809 1 BBa_S04333 annotation2120815 1 BBa_S04336 range2120815 1 209 408 annotation2120809 1 BBa_S04333 range2120809 1 1 200 annotation2120821 1 BBa_S04334 range2120821 1 417 616 BBa_S04333 1 BBa_S04333 K199106:K199002 2009-11-18T12:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 5562 9 Not in stock false false Mary Gearing component2062779 1 BBa_K199106 component2062783 1 BBa_K199002 annotation2062783 1 BBa_K199002 range2062783 1 58 200 annotation2062779 1 BBa_K199106 range2062779 1 1 49 BBa_K199002_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctagtggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_S04333_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtctagtggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199028_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttgaccgacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199106_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacg BBa_S04336_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtttactagacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199001_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttactagacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_S04334_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtttgaccgacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_J100011_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtctagtggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtttactagacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtttgaccgacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z