BBa_J100028 1 BBa_J100028 placeholder insert for BsaI Golden Gate Assembly of promoter 2011-08-29T11:00:00Z 2015-08-31T04:08:22Z Synthesized de novo using DNA sequences from parts in the registry. Typical scars are absent from this DNA. This insert can be placed in any vector that does not contain a BsaI site. BsaI is a type IIs restriction enzyme use in Golden Gate Assembly of multiple inserts. Most versions of ampicillin resistance in plasmids contain a BsaI site. We are putting this insert into a modified pSB1A2 that has its vector BsaI site mutated (see part number ##). This insert can be digested with BsaI and mixed with ligase to make room for a promoter of your choice that has appropriate sticky ends. We are using this insert in combination with new promoters assembled from oligonucleotides (oligos). When assembled, the new promoter would have a four base overhang of 5' GCTG 3' on the left side of the top strand and a four base overhang of 3' CGCC 5' on the right side of the bottom strand: 5' CGACNNN...NNN 3' 3' NNN...NNNCGCC 5' This insert contains BBa biobrick prefix, BbsI site, 4 base overhang followed by BsaI site cutting to the left, transcriptional terminator B0014, BsaI site that cuts to the right, 4 base overhang, BbsI site, RBS B0034, mRFP part number ##) and ending in BBa biobrick suffix. false false _578_ 0 201 61 Not in stock false Had to avoid BsaI sites and BbsI sites as well as all biobrick restriction sites. false Malcolm Campbell annotation2125666 1 BsaI cuts left range2125666 1 34 39 annotation2125664 1 start range2125664 1 176 178 annotation2125662 1 B0034 range2125662 1 158 169 annotation2125667 1 misc range2125667 1 29 32 annotation2125660 1 prefix range2125660 1 1 21 annotation2125663 1 BbsI cuts left range2125663 1 23 28 annotation2125661 1 suffix range2125661 1 858 877 annotation2125671 1 mRFP E1010 range2125671 1 176 856 annotation2125665 1 double stop range2125665 1 851 856 annotation2125668 1 BsaI cuts right range2125668 1 135 140 annotation2125669 1 misc range2125669 1 142 145 annotation2125670 1 BbsI cuts right range2125670 1 146 151 BBa_J100028_sequence 1 gaattcgcggccgcttctagaggtcttccgactgagacctcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattatttggtctcagcgggaagacaactagaaagaggagaaatactagatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z