BBa_J100029 1 BBa_J100029 The promoter of rpoDPhs 2011-08-31T11:00:00Z 2015-08-31T04:08:22Z List of E. coli Gene Promoters: http://margalit.huji.ac.il/promec/prom.seq.final.html Wayne E. Taylor, David B. Straus, Alan D. Grossman, Zachary F. Burton, Carol A. Gross and Richard R. Burgess Transcription from a heat-inducible promoter causes heat shock regulation of the sigma subunit of E. coli RNA polymerase. Cell. Volume 38, Issue 2, September 1984, Pages 371-381 http://www.sciencedirect.com/science/article/pii/0092867484904926 The promoter of the Escherchia Coli gene rpoDPhs is an 76 nucleotide base long sequence with 4 additional nucleotide bases added to each 5' end to create sticky ends to allow for transcription. The promoter of rpoDPhs is inducible by heat shock; therefore, in the abscence of heat the promoter of rpoDPhs is inactive. When activated by the prescence of heat, the promoter of rpoDPhs will begin transcription. false false _578_ 0 10686 9 Not in stock false We added sticky ends to the top left strand and the bottom right. See details: http://partsregistry.org/Part:BBa_J100028 false Maggie Baay BBa_J100029_sequence 1 cttttagagcactatcgtggtacaaataatgctgccacccttgaaaaactgtcgatgtgggacgatatagcagata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z