BBa_J100030 1 BBa_J100030 phoA is an inducible promoter induced by phosphate starvation. 2011-08-31T11:00:00Z 2015-08-31T04:08:22Z CATCCTCGTCAGTAAAAAGTTAATCTTTTCAACAGCTGTCATAAAGTTGTCACGGCCGAGACTTATAGTCGCTTTgTTTTTATTTTTTAATGTATTTGTAC Source: <<http://margalit.huji.ac.il/promec/prom.seq.final.html>> phoA should attach to the missing gap in the plasmid to allow transcription. This promoter is induced by phosphate starvation which means that it can limit protein synthesis. The source of phoA is E. Coli and this promoter is suitable for bacterial cells. phoA typically has 76 base pairs. phoA is inactive in its default state with high levels of phosphate. In the absence of phosphate, phoA is activated. Source: <<http://wolfson.huji.ac.il/expression/vector/Promoters.html#promoters>> false false _578_ 0 10683 9 Not in stock false Add CGCC to the 5' end of the bottom strand and add CGAC to the 5' end of the top strand. false Scott Hall BBa_J100030_sequence 1 catcctcgtcagtaaaaagttaatcttttcaacagctgtcataaagttgtcacggccgagacttatagtcgctttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z