BBa_J100031 1 BBa_J100031 Constitutive promoter C on Gene 1 of T7, transcribes RNA Pol. 2011-08-31T11:00:00Z 2015-08-31T04:08:22Z We found the sequence of the oligo sequence from the paper as well. McConnell DJ. The DNA sequence at the T7 C promoter. Biological Labs, Harvard University. 29 November 1978. Nucleic Acids Research. The C promoter is a constitutive promoter. The virus T7 uses E. Coli's RNA polymerase to transcribe it's own information, using the C promoter on Gene 1. false false _578_ 0 10644 9 Not in stock false http://partsregistry.org/Part:BBa_J100028. We used this website to design and attach sticky ends to our oligo sequences as shown. false Caroline Vrana BBa_J100031_sequence 1 ggatggctatcgctaatggtcttacgctcaacattgataacgcaacttgacgcaatgttaatgggctgatagtcttatcttacaggtcatctgcgggtgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z