BBa_J100032 1 BBa_J100032 proUP3 promoter 2011-08-31T11:00:00Z 2015-08-31T04:08:22Z G. May, E. Faatz, J. M. Lucht, M. Haardt, M. Bolliger^ and E. Bremer. Characterization of the osmoregulated Escherichia coli proU promoter and identification of ProV as a membrane-associated protein. Molecular Microbiology, 1989, 3(11), 1521-1531. http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/024.pdf J Mellies, R Brems, and M Villarejo. The Escherichia coli proU promoter element and its contribution to osmotically signaled transcription activation. Journal of Bacteriology, June 1994, 176(12), 3638???3645. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC205553/ Online list of E. coli gene promoters: http://margalit.huji.ac.il/promec/prom.seq.final.html This 90-bp minimal promoter is induced by osmotic stress and responds the same to various levels of salt shock. false false _578_ 0 10677 9 Not in stock false Added sticky ends to both the 5' and 3' end. See details in: http://partsregistry.org/Part:BBa_J100028 false Molly Marshall BBa_J100032_sequence 1 ggaaattccggcgatttgctcgcatcaatattcatgccacatttgccatcaggggttgcctcagattctcagtatgttagggtagaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z