BBa_J100034 1 BBa_J100034 groE promoter 2011-08-31T11:00:00Z 2015-08-31T04:08:22Z E. coli heat induced promoter. 72 bases upstream of the start site of the gene. 44 base pairs long. false false _578_ 0 10688 9 Not in stock false Number of base pairs had to be less than 90. false Margaret Stebbins BBa_J100034_sequence 1 tttttcccccttgaaggggcgaagccatccccatttctctggtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z