BBa_J100036 1 BBa_J100036 Promoter induced by DNA damage 2011-08-31T11:00:00Z 2015-08-31T04:08:22Z E. coli The promoter of the polB gene from E.coli. Its default state is off, and it is induced by SOS DNA damage, such as exposure to UV light. The promoter increases expression of genes downstream. false false _578_ 0 10666 9 Not in stock false Entered DNA sequence into this tool, http://gcat.davidson.edu/iGem10/index.html, which revealed overlapping oligonucleotide sequences. false Erich Baker BBa_J100036_sequence 1 gactgtataaaaccacagccaatcaaacgaaaccaggctatactcaagcctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z