BBa_J100039 1 BBa_J100039 GalP1 Promoter-Induced By Galactose 2011-08-31T11:00:00Z 2015-08-31T04:08:22Z E.coli - Induced by galactose and repressed by glucose - galP1 is directly upstream of the operon that is induced by galactose - galP1 controls the transcription of galT, galE, and galK false false _578_ 0 10674 9 Not in stock false The Oligator, which can be found at http://gcat.davidson.edu/iGem10/index.html, produced an overlapping sequence. false Anaiah Toby BBa_J100039_sequence 1 aattcttgtgtaaacgattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttatttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z