BBa_J100065 1 BBa_J100065 Synthetic Riboswitch 2012-06-10T11:00:00Z 2015-08-31T04:08:22Z http://www.ncbi.nlm.nih.gov/pubmed?term=Synthetic%20Riboswitches%20That%20Induce%20Gene%20Expression%20in%20Diverse%20Bacterial%20Species This part is a synthetic riboswitch that can be used in E. coli. In the presence of theophylline, the expression of the gene of interest is induced, but in the absence of theophylline, very little transcription takes place. This part contains a modified T5 promoter, which, in the absence of cymR, acts as a strong constitutive promoter. The ribosomal binding site is contained in the riboswitch. false false _578_ 0 10704 9 Not in stock false Because the riboswitch must be directly beside the gene of interest (the start codon is used in the folding of the riboswitch), we added a BsaI recognition site. This allows the riboswitch to be connected directly to a gene of interest using the Golden Gate Assembly method (if the first nucleotide after the start codon of the gene of interest is a C, we made it for use with superfolder GFP). false Rebecca Evans annotation2176244 1 BBa suffix range2176244 1 193 213 annotation2176236 1 lac operator range2176236 1 76 96 annotation2176235 1 T5 promoter range2176235 1 23 75 annotation2176240 1 Riboswitch range2176240 1 125 184 annotation2176234 1 BBa prefix range2176234 1 1 22 annotation2176241 1 RBS range2176241 1 168 172 annotation2176242 1 Start range2176242 1 182 184 annotation2176243 1 GGA prefix ATGC sticky word range2176243 1 182 192 annotation2176239 1 KpnI site range2176239 1 119 124 annotation2176237 1 scar range2176237 1 97 102 annotation2176238 1 constant sequence range2176238 1 104 118 BBa_J100065_sequence 1 gaattcgcggccgcttctagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagatacgactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatgctgagacctactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z