BBa_J100066 1 BBa_J100066 Synthetic Riboswitch 2012-06-11T11:00:00Z 2015-08-31T04:08:22Z http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2988590/?tool=pubmed This part is a synthetic riboswitch that can be used in E. coli. In the presence of theophylline, the expression of the gene of interest is induced, but in the absence of theophylline, very little transcription takes place. This part contains a modified T5 promoter, which, in the absence of cymR, acts as a strong constitutive promoter. The ribosomal binding site is contained in the riboswitch. Because the riboswitch must be right beside the gene of interest (the start codon is folded in the riboswitch), we added a BsaI site. This allows the riboswitch to be attached to the gene of interest using Golden Gate Assembly (as long as the first nucleotide after the start codon of the gene of interest is a C, we designed the part to use with superfolder GFP). This riboswitch is modified from riboswitch E as described in the paper by Topp et al. References: Shana Topp, Colleen M. K. Reynoso, Jessica C. Seeliger, Ian S. Goldlust, Shawn K. Desai, Doroth??e Murat, Aimee Shen, Aaron W. Puri, Arash Komeili, Carolyn R. Bertozzi, June R. Scott, and Justin P. Gallivan. Synthetic Riboswitches That Induce Gene Expression in Diverse Bacterial Species. Applied and Environmental Microbiology, 76:23, 7881-7884. December 2010. false false _578_ 0 10704 9 Not in stock false None false Rebecca Evans annotation2176248 1 scar range2176248 1 97 102 annotation2176250 1 KpnI site range2176250 1 119 124 annotation2176245 1 BBa prefix range2176245 1 1 22 annotation2176255 1 BBa suffix range2176255 1 196 216 annotation2176254 1 GGA suffix ATGC sticky word range2176254 1 185 195 annotation2176251 1 Riboswitch range2176251 1 125 187 annotation2176249 1 constant sequence range2176249 1 104 118 annotation2176253 1 RBS range2176253 1 168 174 annotation2176246 1 T5 promoter range2176246 1 23 75 annotation2176247 1 lac operator range2176247 1 76 96 annotation2176252 1 Start range2176252 1 185 187 BBa_J100066_sequence 1 gaattcgcggccgcttctagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagatacgactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggaggtaacaacaagatgctgagacctactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z