BBa_J100067 1 BBa_J100067 fadB promoter (long sequence) 2012-06-26T11:00:00Z 2015-08-31T04:08:22Z Assembled by oligos from the E. coli sequence. This long version of the fadB promoter is activated by the ArcAB system found in E. coli. false false _578_ 0 10639 9 Not in stock false This is considered the long version because it contains the binding site for ArcA. false Meredith Nakano annotation2177369 1 +1 range2177369 1 61 61 annotation2177370 1 -35 range2177370 1 26 26 annotation2177367 1 FadR range2177367 1 61 76 annotation2177368 1 -10 range2177368 1 51 51 annotation2177366 1 Fis range2177366 1 25 44 annotation2177365 1 ArcA site range2177365 1 25 40 BBa_J100067_sequence 1 atcggcatttctttaatcttttgtttgcatatttttaacacaaaatacacacttcgactcatctggtacgaccagatcaccttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z