BBa_J100068 1 BBa_J100068 fadB promoter (short sequence) 2012-06-26T11:00:00Z 2015-08-31T04:08:22Z From E. coli and assembled by oligos. This short sequence of the FadB promoter is repressed by phosphorylated ArcA which is part of the ArcAB system in E. coli. It is activated by Fis. ArcA and Fis have overlapping binding sites. Unlike the long version of this promoter, the short sequence is not activated by FadR since it is missing the FadR binding site. http://mic.sgmjournals.org/content/152/8/2207.full.pdf+html false false _578_ 0 10639 9 Not in stock false This part was designed without the activation binding site of FadR so that the promoter may be repressed more readily. false Meredith Nakano annotation2177371 1 -10 range2177371 1 51 51 annotation2177373 1 -35 range2177373 1 26 26 annotation2177372 1 +1 range2177372 1 61 61 annotation2177374 1 ArcA range2177374 1 25 40 annotation2177375 1 Fis range2177375 1 25 44 BBa_J100068_sequence 1 atcggcatttctttaatcttttgtttgcatatttttaacacaaaatacacacttcgactca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z