BBa_J100069 1 BBa_J100069 Superfolder GFP 2012-06-27T11:00:00Z 2015-08-31T04:08:22Z Synthetic part using part I746916. This part is the coding sequence for superfolder GFP with a BsaI restriction site at the beginning for use with the Golden Gate Assembly method. The BsaI site cuts forward cleaving the sequence right before the start codon. The sticky word made is ATGC (the start codon and the first base pair of the sequence). false false _578_ 0 10704 9 Not in stock false I used specifically designed PCR primers to add the Biobrick ends and the BsaI site. false Rebecca Evans annotation2177431 1 Bba prefix range2177431 1 1 22 annotation2177435 1 double stop range2177435 1 744 749 annotation2177433 1 superfolder GFP range2177433 1 30 749 annotation2177432 1 BsaI site ATGC sticky word range2177432 1 23 33 annotation2177434 1 start codon range2177434 1 30 32 annotation2177430 1 Bba suffix range2177430 1 750 770 BBa_J100069_sequence 1 gaattcgcggccgcttctagagggtctctatgcgtaaaggcgaagagctgttcaccggtgttgttccgattctggttgaactggatggtgatgttaatggccacaaattttcagttcgtggtgaaggcgagggtgatgcaaccaatggtaaactgaccctgaaatttatctgtaccaccggcaaactgccggttccgtggccgaccctggttaccaccctgacctatggtgttcagtgttttgcacgttatccggatcatatgaaacagcacgattttttcaaaagcgcaatgccggaaggttatgttcaagaacgtaccatctcctttaaagatgatggcacctataaaacccgtgccgaagttaaatttgaaggtgacaccctggtgaatcgtattgagctgaaaggcatcgatttcaaagaggatggtaatatcctgggccataaactggaatataacttcaatagccacaatgtgtatatcaccgcagacaaacagaaaaacggcattaaagccaactttaagattcgccataatgtggaagatggtagcgtgcagctggcagatcattatcagcagaataccccgattggtgatggtccggttctgctgccggataatcactatctgagcacccagagcgttctgagcaaagatccgaatgaaaaacgtgatcacatggtgctgctggaatttgttaccgcagcaggtattacccatggtatggatgaactgtacaaatgatgatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z