BBa_J100071 1 BBa_J100071 cadA promoter 2012-07-04T11:00:00Z 2015-08-31T04:08:22Z Taken from ''E. coli'' genome through PCR. The promoter for the cadBA operon in ''E. coli''. It is induced by low pH ([http://ecocyc.org/ECOLI/NEW-IMAGE?type=GENE-IN-MAP&object=EG10131 cadA gene]). CadC senses external pH, by low pH preventing the formation of a disulfide bond, activating CadC. When activated, CadC binds to two sites upstream of the cadBA promoter, Cad1 and Cad2. The binding of CadC to these sites activates transcription by releasing the H-NS molecules that are bound to, and repressing, the cadBA operon ([http://ecocyc.org/ECOLI/NEW-IMAGE?type=ENZYME&object=PD00436 CadC function in cadBA operon]). false true _578_ 0 13950 9 Not in stock false We cloned the promoter region 334 bp upstream of the transcription start site, in which Cad1 and Cad2 are included. false Ben Clarkson annotation2177460 1 H-NS binding site range2177460 1 153 167 annotation2177458 1 H-NS binding site range2177458 1 68 82 annotation2177463 1 Cad1 binding site range2177463 1 188 225 annotation2177461 1 H-NS binding site range2177461 1 199 213 annotation2177462 1 H-NS binding site range2177462 1 296 310 annotation2177459 1 H-NS binding site range2177459 1 149 163 annotation2177457 1 H-NS binding site range2177457 1 11 25 annotation2177466 1 -10 range2177466 1 320 326 annotation2177467 1 -35 range2177467 1 298 306 annotation2177464 1 Cad2 binding site range2177464 1 249 279 BBa_J100071_sequence 1 ccttatgttgtaccttatctcgacaaatttcttgcttcagaataagtaactccgggttgatttatgctcggaaatatttgttgttgagtttttgtatgttcctgttggtataatatgttgcggcaatttatttgccgcataatttttattacataaatttaaccagagaatgtcacgcaatccattgtaaacattaaatgtttatcttttcatgatatcaacttgcgatcctgatgtgttaataaaaaacctcaagttctcacttacagaaacttttgtgttatttcacctaatctttaggattaatccttttttcgtgagtaatcttatcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z