BBa_J100072 1 BBa_J100072 LcpxP promoter--Long cpxP promoter 2012-07-04T11:00:00Z 2015-08-31T04:08:22Z This part was cloned from the ''E. coli'' genome using PCR. The promoter for the cpxP gene in ''E. coli'', which is involved in responses to cytoplasmic stresses ([http://ecocyc.com/ECOLI/NEW-IMAGE?type=GENE-IN-MAP&object=G7816 cpxP gene in ''E. coli'']). Transcription is activated by high pH via the CpxAR two-component signal transduction pathway. Alkaline pH activates CpxA, an autokinase, which then phosphorylates CpxR. CpxR then activates cpxP and degP. DegP degrades cpxP, and cpxP inhibits the autokinase activity of CpxA ([http://ecocyc.com/ECOLI/NEW-IMAGE?type=ENZYME&object=PHOSPHO-CPXR CpxAR two-component signal transduction pathway in ''E. coli'']). false false _578_ 0 13950 9 Not in stock false This promoter includes 392 bp upstream of the transcription start site. false Ben Clarkson annotation2177465 1 CpxR-phosphorylated range2177465 1 329 343 annotation2177469 1 CpxR-phosphorylated range2177469 1 374 392 annotation2177468 1 CpxR-phosphorylated range2177468 1 349 363 BBa_J100072_sequence 1 ctcaaggccgagaacgcgatcaagttcactgccgcgcgccgtcaacataatgacaggcgtctggtgtgtctggcgaagtgcttttaatgtgtcgataccatttttcttcggcatcattacgtcaagcaaaagtaaatcaatgctgtcgtccagaagatcaagcgcctgttccccatcgtgggcaacaatcacgttgaagccttccatctcgagcagctcctttaatagggaagtcagctctcggtcatcatcaactaacaggattttattcattgtttaaatacctccgaggcagaaattacgtcatcagacgtcgctaatccatgactttacgttgttttacaccccctgacgcatgtttgcagcctgaatcgtaaactctctatcgttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z