BBa_J100073 1 BBa_J100073 ScpxP--Short cpxP promoter 2012-07-04T11:00:00Z 2015-08-31T04:08:22Z Cloned from ''E. coli'' genome using PCR The promoter for the cpxP gene in ''E. coli'', which is involved in responses to cytoplasmic stresses ([http://ecocyc.com/ECOLI/NEW-IMAGE?type=GENE-IN-MAP&object=G7816 cpxP gene in ''E. coli'']). Transcription is activated by high pH via the CpxAR two-component signal transduction pathway. Alkaline pH activates CpxA, an autokinase, which then phosphorylates CpxR. CpxR then activates cpxP and degP. DegP degrades cpxP, and cpxP inhibits the autokinase activity of CpxA ([http://ecocyc.com/ECOLI/NEW-IMAGE?type=ENZYME&object=PHOSPHO-CPXR CpxAR two-component signal transduction pathway in ''E. coli'']). false false _578_ 0 13950 9 Not in stock false This promoter includes 94 bp upstream from the transcription start site. false Ben Clarkson annotation2177470 1 CpxR-phosphorylated range2177470 1 31 45 annotation2177472 1 CpxR-phosphorylated range2177472 1 76 94 annotation2177471 1 CpxR-phosphorylated range2177471 1 51 65 BBa_J100073_sequence 1 ttacgtcatcagacgtcgctaatccatgactttacgttgttttacaccccctgacgcatgtttgcagcctgaatcgtaaactctctatcgttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z