BBa_J100074 1 BBa_J100074 Long pLux Promoter 2012-07-04T11:00:00Z 2015-08-31T04:08:22Z E. coli This is the long form of the pLux promoter. This promoter promotes the luxR gene but only in the presence of 30C6. The shorter form of the pLux promoter does not include an arcA binding site. Phosphorylated arcA typically represses this long promoter in anaerobic conditions. false false _578_ 0 10640 9 Not in stock false This part includes 2 ArcA binding sites as well as a CRP site. It starts 238 bp upstream of the transcription factor. false Betsy Gammon annotation2177478 1 +1 range2177478 1 197 197 annotation2177475 1 CRP binding site range2177475 1 84 109 annotation2177476 1 LuxR binding site range2177476 1 145 165 annotation2177477 1 -10 range2177477 1 188 188 annotation2177473 1 ArcA binding site 2 range2177473 1 94 109 annotation2177474 1 arcA binding site 1 range2177474 1 127 144 BBa_J100074_sequence 1 catctctttatccttacctattgtttgtcgcaagttttgcgtgttatatatcattaaaacggtaatggattgacatttgattctaataaattggatttttgtcacactattgtatcgctgggaatacaattacttaacataagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z