BBa_J100075 1 BBa_J100075 CydAP1 Long Promoter 2012-07-04T11:00:00Z 2015-08-31T04:08:22Z E. coli This promoter promotes the cydA and cydB genes. It is regulated by Fnr as well as arcA. While Fnr represses this promoter, phosphorylated arcA relieves this repression to induce the expression of the cydAB gene. This long version of the sequence includes 1 arcA binding site and 2 complete Fnr binding sites. In aerobic conditions, arcA is not phosphorylated, so Fnr represses the promoter. However, when arcA is phosphorylated in anaerobic conditions, the promoter is relived of the repression from Fnr. false false _578_ 0 10640 9 Not in stock false The second Fnr site extends beyond the start of the transcription factor. false Betsy Gammon annotation2177484 1 +1 range2177484 1 151 151 annotation2177479 1 arcA binding site range2177479 1 35 84 annotation2177482 1 -35 range2177482 1 116 116 annotation2177481 1 Fnr binding site 1 range2177481 1 143 158 annotation2177483 1 -10 range2177483 1 141 141 annotation2177480 1 Fnr binding site 2 range2177480 1 91 105 BBa_J100075_sequence 1 aactaatttcagccttataactcacacattttaaacataaatgtcagtaaagttaccttattgaaacatgattaacataatttgtaggaattgatatttatcaatgtataagtcttggaaatgggcatcaaaaagagataaattgttctcgatcaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z