BBa_J100076 1 BBa_J100076 CydAP1 Short Promoter 2012-07-04T11:00:00Z 2015-08-31T04:08:22Z E. coli This promoter promotes the cydA and cydB genes. It is regulated by Fnr as well as arcA. While Fnr represses this promoter, phosphorylated arcA relieves this repression to induce the expression of the cydAB gene. This short version of the sequence includes 1 arcA binding site and 1 complete Fnr binding sites. In aerobic conditions, arcA is not phosphorylated, so Fnr represses the promoter. However, when arcA is phosphorylated in anaerobic conditions, the promoter is relived of the repression from Fnr. false false _578_ 0 10640 9 Not in stock false There is a second Fnr binding site; however it extends beyond the +1 site. Thus, this second binding site is incomplete, and Fnr will likely not be able to bind to it. false Betsy Gammon annotation2177487 1 arcA binding site range2177487 1 35 84 annotation2177488 1 Fnr binding site range2177488 1 91 105 annotation2177485 1 +1 range2177485 1 151 151 annotation2177486 1 -10 range2177486 1 141 141 annotation2177489 1 -35 range2177489 1 116 116 BBa_J100076_sequence 1 aactaatttcagccttataactcacacattttaaacataaatgtcagtaaagttaccttattgaaacatgattaacataatttgtaggaattgatatttatcaatgtataagtcttggaaatgggcatcaaaaagagataaattgttctcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z