BBa_J100085 1 BBa_J100085 short CRISPR sequence with GFP target spacer 2012-07-12T11:00:00Z 2015-08-31T04:08:22Z Oligos from a designed sequence. The CRISPR system (Clustered Regularly Interspaced Short Palindromic Repeats) acts as a bacterial immune system. This sequence is a synthetic CRISPR system used in E.coli. It includes a short 30 bp sequence that targets the GFP gene (E0040). It is cloned into the plasmid pSB1K8. false false _578_ 0 10644 9 Not in stock false The CRISPR repeats made it difficult to not have inappropriate base pair matching with oligos. false Caroline Vrana BBa_J100085_sequence 1 aattcgcggccgcttctagagaaacaaagaattagctgatctttaataataaggaaatgttacattaaggttggtgggttgtttttatgggaaaaaatgctttaagaacaaatgtatacttttagacggtttatccccgctggcgcggggaactcaatactccaattggcgatggccctgccttcggtttatccccgctggcgcggggaactcggatcctactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z