BBa_J100093 1 BBa_J100093 rrnB P1 promoter 2012-09-12T11:00:00Z 2015-08-31T04:08:22Z "Transcription of the Escherichia coli rub P1 Promoter by the Heat Shock RNA Polymerase (E32) In Vitro" JANETT NEWLANDS, TAMAS GAAL, JOAN MECSAS, RICHARD L. GOURSE Department of Bacteriology, University of Wisconsin, http://www.ncbi.nlm.nih.gov/pmc/articles/PMC196203/pdf/jbacter00045-0095.pdf rrnB is an E. Coli promoter that is tightly controlled by: Inducer: rhamnose and also responds to heat shock false false _578_ 0 14598 9 Not in stock false We trimmed the first 10 bases of the DNA sequence starting from the far left in order to make the sequence short enough. false Kayla McAvoy annotation2182748 1 Esigma32 range2182748 1 23 29 annotation2182749 1 Esigma32 range2182749 1 9 17 BBa_J100093_sequence 1 ttttaaatttcctcttgtcaggcccgaataactccctataatgcgccaccactgacacgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z