BBa_J100094 1 BBa_J100094 Lac promoter E. Coli 2012-09-12T11:00:00Z 2015-08-31T04:08:22Z The Lac gene in E. Coli. http://www.ncbi.nlm.nih.gov/pubmed/2547970 This promoter regulates the transcription of the lac operon in Escherichia Coli. The lac operon controls the digestion of lactose, a disaccharide, within the cell. false false _578_ 0 14608 9 Not in stock false The Lac promoter was originally 75 bases long, but it had to be cut to approximately 40. No other considerations were made. false Cameron Bard BBa_J100094_sequence 1 ccccaggctttacactttatgcttccggctcgtatgttgtgtgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z