BBa_J100096 1 BBa_J100096 PBAD Promoter from araE Gene 2012-09-12T11:00:00Z 2015-08-31T04:08:22Z http://www.cf.ac.uk/biosi/staffinfo/ehrmann/tools/dna/pBAD22.html http://mic.sgmjournals.org/content/147/12/3241.full.pdf Artem Khlebnikov; "Homogeneous expression of the PBAD promoter in Escherichia coli by constitutive expression of the low-affinity high-capacity AraE transporter;" Microbiology (2001), 147, 3241???3247. The PBAD promoter is arabinose-induced from the araE gene. Once induced, the gene it is promoting is expressed in an "all-or-none" fashion. false false _578_ 0 14630 9 Not in stock false N/A false Elizabeth Brunner BBa_J100096_sequence 1 gacgctttttatcgcaactctctactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z